Encomenda rápida

Ratazanao Serum amyloid P component clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Mouse APCS Informações sobre o produto de clone de cDNA
Tamanho de cDNA:675bp
Descrição de cDNA:Full length Clone DNA of Mus musculus serum amyloid P-component with N terminal His tag.
Sinónimo de gene:Sap
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Ratazanao Serum amyloid P component clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta on other vectors
Ratazanao Serum amyloid P component clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaMG50113-ACG$225
Ratazanao Serum amyloid P component clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaMG50113-ACR$225
Ratazanao Serum amyloid P component clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaMG50113-CF$195
Ratazanao Serum amyloid P component clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaMG50113-CH$195
Ratazanao Serum amyloid P component clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaMG50113-CM$195
Ratazanao Serum amyloid P component clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaMG50113-CY$195
Ratazanao Serum amyloid P component clonagem de ADN ou de clonagem do gene (vector de expressão)MG50113-M$75
Ratazanao Serum amyloid P component clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaMG50113-NF$195
Ratazanao Serum amyloid P component clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaMG50113-NH$195
Ratazanao Serum amyloid P component clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaMG50113-NM$195
Ratazanao Serum amyloid P component clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaMG50113-NY$195
Ratazanao Serum amyloid P component clonagem de ADN ou de clonagem do gene (vector de clonagem)MG50113-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name

Serum amyloid P component (SAP) is the identical serum form of amyloid P component (AP), a highly preserved plasma protein named for its ubiquitous presence in amyloid deposits. As a normal plasma protein first identified as the pentagonal constituent of in vivo pathological deposits called "amyloid". Serum amyloid P component represents another member of the pentraxin family, a highly conserved group of molecules that may play a role in innate immunity. SAP is a key negative regulator for innate immune responses to DNA and may be partly responsible for the insufficient immune responses after DNA vaccinations in humans. SAP suppression may be a novel strategy for improving efficacy of human DNA vaccines and requires further clinical investigations.

  • Wang Y, et al. (2011) Human serum amyloid P functions as a negative regulator of the innate and adaptive immune responses to DNA vaccines. J Immunol. 186(5): 2860-70.
  • Hawkins PN. (2002) Serum amyloid P component scintigraphy for diagnosis and monitoring amyloidosis. Curr Opin Nephrol Hypertens. 11(6): 649-55.
  • Noursadeghi M, et al. (2000) Role of serum amyloid P component in bacterial infection: protection of the host or protection of the pathogen. Proc Natl Acad Sci U S A. 97: 14584-9.
  • de Haas CJ. (1999) New insights into the role of serum amyloid P component, a novel lipopolysaccharide-binding protein. FEMS Immunol Med Microbiol. 26(3-4): 197-202.
  • Size / Price
    Catálogo: MG50113-NH
    Preço de catálogo: 
    Preço:      (You Save: )
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.