After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Ratazanao FE65/APBB1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Mouse APBB1 Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_001253885.1
Tamanho de cDNA:2133bp
Descrição de cDNA:Full length Clone DNA of Mus musculus amyloid beta (A4) precursor protein-binding, family B, member 1 with C terminal His tag.
Sinónimo de gene:Rir, Fe65
Espécie:Mouse
Vetor:pCMV3-C-His
Plasmid:
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Ratazanao FE65/APBB1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta on other vectors
Ratazanao FE65/APBB1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaMG51732-ACG$245
Ratazanao FE65/APBB1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaMG51732-ACR$245
Ratazanao FE65/APBB1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaMG51732-ANG$245
Ratazanao FE65/APBB1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaMG51732-ANR$245
Ratazanao FE65/APBB1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaMG51732-CF$215
Ratazanao FE65/APBB1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaMG51732-CH$215
Ratazanao FE65/APBB1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaMG51732-CM$215
Ratazanao FE65/APBB1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaMG51732-CY$215
Ratazanao FE65/APBB1 clonagem de ADN ou de clonagem do gene (vector de expressão)MG51732-G$75
Ratazanao FE65/APBB1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaMG51732-NF$215
Ratazanao FE65/APBB1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaMG51732-NH$215
Ratazanao FE65/APBB1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaMG51732-NM$215
Ratazanao FE65/APBB1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaMG51732-NY$215
Ratazanao FE65/APBB1 clonagem de ADN ou de clonagem do gene (vector de clonagem)MG51732-UT$215
 Saiba mais sobre vectores de expressão
Product nameProduct name
Size / Price
Catálogo: MG51732-CH
Preço de catálogo: 
Preço:      (You Save: )
Tamanho:
Quantidade:+-
Disponibilidade2-3 weeks
Bulk Discount RequiryAcrescentar a carrinho
Contact Us
Imagens
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"