Encomenda rápida

Ratazanao Annexin VI/ANXA6 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag Etiqueta

    Folha de dadosAnálisesProdutos relacionadosProtocolos
    Rato ANXA6 Informações sobre o produto de clone de cDNA
    Gene_bank_ref_id:NM_001110211.1
    Tamanho de cDNA:2022bp
    Descrição de cDNA:Full length Clone DNA of Mus musculus annexin A6 with C terminal Flag tag.
    Sinónimo de gene:Anx6, Cabm, Camb, AnxVI, AW107198
    Espécie:Mouse
    Vetor:pCMV3-C-FLAG
    Plasmid:
    Local de restrição:
    Sequência de etiqueta:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
    Descrição da sequência:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with ANXA6 qPCR primers for gene expression analysis, MP202092 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
    FLAG Tag Info

    FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

    The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

    Ratazanao Annexin VI/ANXA6 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag Etiqueta on other vectors
    Ratazanao Annexin VI/ANXA6 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaMG52219-ACG$245
    Ratazanao Annexin VI/ANXA6 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaMG52219-ACR$245
    Ratazanao Annexin VI/ANXA6 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaMG52219-ANG$245
    Ratazanao Annexin VI/ANXA6 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaMG52219-ANR$245
    Ratazanao Annexin VI/ANXA6 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaMG52219-CF$215
    Ratazanao Annexin VI/ANXA6 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaMG52219-CH$215
    Ratazanao Annexin VI/ANXA6 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaMG52219-CM$215
    Ratazanao Annexin VI/ANXA6 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaMG52219-CY$215
    Ratazanao Annexin VI/ANXA6 clonagem de ADN ou de clonagem do gene (vector de expressão)MG52219-G$75
    Ratazanao Annexin VI/ANXA6 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaMG52219-NF$215
    Ratazanao Annexin VI/ANXA6 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaMG52219-NH$215
    Ratazanao Annexin VI/ANXA6 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaMG52219-NM$215
    Ratazanao Annexin VI/ANXA6 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaMG52219-NY$215
    Ratazanao Annexin VI/ANXA6 clonagem de ADN ou de clonagem do gene (vector de clonagem)MG52219-UT$215
     Saiba mais sobre vectores de expressão
    Product nameProduct name
    Fundo

    Annexin A6, also known as ANXA6 or ANXAⅥ, belongs to a family of Ca2+-dependent membrane and phospholipid binding proteins. Members of this family have been implicated in membrane-related events along exocytotic and endocytotic pathways. Annexin 6 is phosphorylated in vivo associated with cell growth. Annexin 6 was not phosphorylated in quiescent cells, but was phosphorylated on serine and to a lesser extent threonine, several hours following cell stimulation. Experiment has revealed the presence of annexin A6 on the cell surface of variety cells as putative receptors and / or binding proteins for chondroitin sulfate proteoglycans, helping cells to bind with this extracellular matrix glycosaminoglycan chondroitin sulfate which is related to the cell-substratum adhesion. A post-tranlational modification other than direct protein phosphorylation may influence the activity of annexin6 and provide evidence linking cell growth with regulation of annexin 6 function. 

    Referências
  • Takagi H, et al. (2002) Annexin 6 is a putative cell surface receptor for chondroitin sulfate chains. J Cell Sci. 115 (16): 3309-18.
  • Moss SE, et al. (1992) A growth-dependent post-translational modification of annexin VI. Biochim Biophys Acta. 1160 (1): 120-6.
  • Song G, et al. (1998) Altered cardiac annexin mRNA and protein levels in the left ventricle of patients with end-stage heart failure. J Mol Cell Cardio. 30 (3): 443-51.
  • Size / Price
    Catálogo: MG52219-CF
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade
    Acrescentar a carrinhoBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
      Itens recentemente visualizados
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"