Encomenda rápida

Ratazanao Apc2/ANAPC2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta

    Folha de dadosAnálisesProdutos relacionadosProtocolos
    Rato ANAPC2 Informações sobre o produto de clone de cDNA
    Gene_bank_ref_id:NM_175300.4
    Tamanho de cDNA:2514bp
    Descrição de cDNA:Full length Clone DNA of Mus musculus anaphase promoting complex subunit 2 with N terminal His tag.
    Sinónimo de gene:Apc2, Emi4, Imi4, AL024279, mKIAA1406, 9230107K09Rik
    Espécie:Mouse
    Vetor:pCMV3-N-His
    Plasmid:
    Local de restrição:
    Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Descrição da sequência:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with ANAPC2 qPCR primers for gene expression analysis, MP201996 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    Ratazanao Apc2/ANAPC2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta on other vectors
    Ratazanao Apc2/ANAPC2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaMG52123-ACG$325
    Ratazanao Apc2/ANAPC2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaMG52123-ACR$325
    Ratazanao Apc2/ANAPC2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaMG52123-ANG$325
    Ratazanao Apc2/ANAPC2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaMG52123-ANR$325
    Ratazanao Apc2/ANAPC2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaMG52123-CF$295
    Ratazanao Apc2/ANAPC2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaMG52123-CH$295
    Ratazanao Apc2/ANAPC2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaMG52123-CM$295
    Ratazanao Apc2/ANAPC2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaMG52123-CY$295
    Ratazanao Apc2/ANAPC2 clonagem de ADN ou de clonagem do gene (vector de expressão)MG52123-G$75
    Ratazanao Apc2/ANAPC2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaMG52123-NF$295
    Ratazanao Apc2/ANAPC2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaMG52123-NH$295
    Ratazanao Apc2/ANAPC2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaMG52123-NM$295
    Ratazanao Apc2/ANAPC2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaMG52123-NY$295
    Ratazanao Apc2/ANAPC2 clonagem de ADN ou de clonagem do gene (vector de clonagem)MG52123-UT$295
     Saiba mais sobre vectores de expressão
    Product nameProduct name
    Size / Price
    Catálogo: MG52123-NH
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade
    Acrescentar a carrinhoBulk Discount Requiry

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"