Encomenda rápida

Text Size:AAA

Ratazanao ALOX5AP / 5-lipoxygenase-activating Proteína clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Mouse ALOX5AP Informações sobre o produto de clone de cDNA
Tamanho de cDNA:486bp
Descrição de cDNA:Full length Clone DNA of Mus musculus arachidonate 5-lipoxygenase activating protein with N terminal HA tag.
Sinónimo de gene:Flap
Local de restrição:
Sequência de etiqueta:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Ratazanao ALOX5AP / 5-lipoxygenase-activating Proteína clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA Etiqueta on other vectors
Ratazanao ALOX5AP / 5-lipoxygenase-activating Proteína clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaMG52815-ACG$225
Ratazanao ALOX5AP / 5-lipoxygenase-activating Proteína clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaMG52815-ACR$225
Ratazanao ALOX5AP / 5-lipoxygenase-activating Proteína clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaMG52815-ANG$225
Ratazanao ALOX5AP / 5-lipoxygenase-activating Proteína clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaMG52815-ANR$225
Ratazanao ALOX5AP / 5-lipoxygenase-activating Proteína clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaMG52815-CF$195
Ratazanao ALOX5AP / 5-lipoxygenase-activating Proteína clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaMG52815-CH$195
Ratazanao ALOX5AP / 5-lipoxygenase-activating Proteína clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaMG52815-CM$195
Ratazanao ALOX5AP / 5-lipoxygenase-activating Proteína clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaMG52815-CY$195
Ratazanao ALOX5AP / 5-lipoxygenase-activating Proteína clonagem de ADN ou de clonagem do gene (vector de expressão)MG52815-G$75
Ratazanao ALOX5AP / 5-lipoxygenase-activating Proteína clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaMG52815-NF$195
Ratazanao ALOX5AP / 5-lipoxygenase-activating Proteína clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaMG52815-NH$195
Ratazanao ALOX5AP / 5-lipoxygenase-activating Proteína clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaMG52815-NM$195
Ratazanao ALOX5AP / 5-lipoxygenase-activating Proteína clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaMG52815-NY$195
Ratazanao ALOX5AP / 5-lipoxygenase-activating Proteína clonagem de ADN ou de clonagem do gene (vector de clonagem)MG52815-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name

Arachidonate 5-Lipoxygenase-Activating Protein (ALOX5AP), also known as FLAP, belongs to the MAPEG family. ALOX5AP/FLAP is an essential partner of 5-LO for this process. The FLAP (ALOX5AP) gene has been linked to risk for myocardial infarction, stroke and restenosis, reigniting pharmaceutical interest in this target. It had been found that ALOX5AP/FLAP is a key enzyme in leukotriene formation, in both human pulmonary microvascular endothelial cells and a transformed human brain endothelial cell line. In addition, the protein FLAP has recently been identified as an emerging target in metabolic disease. In fact, FLAP is overexpressed in the adipose tissue of patients and experimental animals with obesity.

  • Gonsalves CS, et al. (2010) Hypoxia-mediated expression of 5-lipoxygenase-activating protein involves HIF-1alpha and NF-kappaB and microRNAs 135a and 199a-5p. J Immunol. 184(7): 3878-88.
  • Zintzaras E, et al. (2009) Variants of the arachidonate 5-lipoxygenase-activating protein (ALOX5AP) gene and risk of stroke: a HuGE gene-disease association review and meta-analysis. Am J Epidemiol. 169(5): 523-32.
  • Evans JF, et al. (2008) What's all the FLAP about?: 5-lipoxygenase-activating protein inhibitors for inflammatory diseases. Trends Pharmacol Sci. 29(2): 72-8.
  • Bck M, et al. (2007) 5-Lipoxygenase-activating protein: a potential link between innate and adaptive immunity in atherosclerosis and adipose tissue inflammation. Circ Res. 100: 946-9.
  • Size / Price
    Catálogo: MG52815-NY
    Preço de catálogo: 
    Preço:      (You Save: )
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.