Aldolase C/ALDOC cDNA ORF Clone, Mouse, C-DDK (Flag®) tag

Cat: MG52772-CF

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All Aldolase C/ALDOC Reagents

CRO Services

Product recommended


All Aldolase C/ALDOC Reagents

Aldolase C/ALDOC cDNA ORF Clone, Mouse, C-DDK (Flag®) tag General Information

Gene

Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1092 bp
Description
Full length Clone DNA of Mouse aldolase C, fructose-bisphosphate with C terminal Flag tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Aldolase C/ALDOC cDNA ORF Clone, Mouse, C-DDK (Flag®) tag Alternative Names

AI847350 cDNA ORF Clone, Mouse;Aldo3 cDNA ORF Clone, Mouse;AU040929 cDNA ORF Clone, Mouse;Scrg2 cDNA ORF Clone, Mouse

Aldolase C/ALDOC Background Information

Full Name
aldolase C, fructose-bisphosphate

Aldolase C/ALDOC cDNA ORF Clone, Cynomolgus, Related Products

Product Name Catalog#(PDF)
Aldolase C/ALDOC cDNA ORF Clone in Cloning Vector, Cynomolgus CG90559-G
Aldolase C/ALDOC cDNA ORF Clone, Cynomolgus, untagged CG90559-UT
Aldolase C/ALDOC Lentiviral cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90559-ACGLN
Aldolase C/ALDOC cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90559-ACG
Aldolase C/ALDOC cDNA ORF Clone, Cynomolgus, N-GFPSpark® tag CG90559-ANG
Aldolase C/ALDOC cDNA ORF Clone, Cynomolgus, C-OFPSpark® tag CG90559-ACR
Aldolase C/ALDOC cDNA ORF Clone, Cynomolgus, N-OFPSpark® tag CG90559-ANR
Aldolase C/ALDOC cDNA ORF Clone, Cynomolgus, C-DDK (Flag®) tag CG90559-CF
Aldolase C/ALDOC cDNA ORF Clone, Cynomolgus, N-DDK (Flag®) tag CG90559-NF
Aldolase C/ALDOC cDNA ORF Clone, Cynomolgus, C-His tag CG90559-CH
Aldolase C/ALDOC cDNA ORF Clone, Cynomolgus, N-His tag CG90559-NH
Aldolase C/ALDOC cDNA ORF Clone, Cynomolgus, C-HA tag CG90559-CY
Aldolase C/ALDOC cDNA ORF Clone, Cynomolgus, N-HA tag CG90559-NY
Aldolase C/ALDOC cDNA ORF Clone, Cynomolgus, C-Myc tag CG90559-CM
Aldolase C/ALDOC cDNA ORF Clone, Cynomolgus, N-Myc tag CG90559-NM

Aldolase C/ALDOC cDNA ORF Clone, Canine, Related Products

Product Name Catalog#(PDF)
Aldolase C/ALDOC cDNA ORF Clone in Cloning Vector, Canine DG70204-U
Aldolase C/ALDOC cDNA ORF Clone, Canine, untagged DG70204-UT
Aldolase C/ALDOC Lentiviral cDNA ORF Clone, Canine, C-GFPSpark® tag DG70204-ACGLN
Aldolase C/ALDOC cDNA ORF Clone, Canine, C-GFPSpark® tag DG70204-ACG
Aldolase C/ALDOC cDNA ORF Clone, Canine, N-GFPSpark® tag DG70204-ANG
Aldolase C/ALDOC cDNA ORF Clone, Canine, C-OFPSpark® tag DG70204-ACR
Aldolase C/ALDOC cDNA ORF Clone, Canine, N-OFPSpark® tag DG70204-ANR
Aldolase C/ALDOC cDNA ORF Clone, Canine, C-DDK (Flag®) tag DG70204-CF
Aldolase C/ALDOC cDNA ORF Clone, Canine, N-DDK (Flag®) tag DG70204-NF
Aldolase C/ALDOC cDNA ORF Clone, Canine, C-His tag DG70204-CH
Aldolase C/ALDOC cDNA ORF Clone, Canine, N-His tag DG70204-NH
Aldolase C/ALDOC cDNA ORF Clone, Canine, C-HA tag DG70204-CY
Aldolase C/ALDOC cDNA ORF Clone, Canine, N-HA tag DG70204-NY
Aldolase C/ALDOC cDNA ORF Clone, Canine, C-Myc tag DG70204-CM
Aldolase C/ALDOC cDNA ORF Clone, Canine, N-Myc tag DG70204-NM

Aldolase C/ALDOC cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
Aldolase C/ALDOC cDNA ORF Clone in Cloning Vector, Rat RG82409-U
Aldolase C/ALDOC Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG82409-ACGLN

Aldolase C/ALDOC cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
Aldolase C/ALDOC cDNA ORF Clone in Cloning Vector, Mouse MG52772-G
Aldolase C/ALDOC cDNA ORF Clone, Mouse, untagged MG52772-UT
Aldolase C/ALDOC cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52772-ACG
Aldolase C/ALDOC Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52772-ACGLN
Aldolase C/ALDOC cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52772-ANG
Aldolase C/ALDOC cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52772-ACR
Aldolase C/ALDOC cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52772-ANR
Aldolase C/ALDOC cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52772-NF
Aldolase C/ALDOC cDNA ORF Clone, Mouse, C-His tag MG52772-CH
Aldolase C/ALDOC cDNA ORF Clone, Mouse, N-His tag MG52772-NH
Aldolase C/ALDOC cDNA ORF Clone, Mouse, C-HA tag MG52772-CY
Aldolase C/ALDOC cDNA ORF Clone, Mouse, N-HA tag MG52772-NY
Aldolase C/ALDOC cDNA ORF Clone, Mouse, C-Myc tag MG52772-CM
Aldolase C/ALDOC cDNA ORF Clone, Mouse, N-Myc tag MG52772-NM

Aldolase C/ALDOC cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Aldolase C/ALDOC cDNA ORF Clone in Cloning Vector, Human HG11284-M
Aldolase C/ALDOC cDNA ORF Clone, Human, untagged HG11284-UT
Aldolase C/ALDOC cDNA ORF Clone, Human, C-GFPSpark® tag HG11284-ACG
Aldolase C/ALDOC Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11284-ACGLN
Aldolase C/ALDOC cDNA ORF Clone, Human, N-GFPSpark® tag HG11284-ANG
Aldolase C/ALDOC cDNA ORF Clone, Human, C-OFPSpark® tag HG11284-ACR
Aldolase C/ALDOC cDNA ORF Clone, Human, N-OFPSpark® tag HG11284-ANR
Aldolase C/ALDOC cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11284-CF
Aldolase C/ALDOC cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11284-NF
Aldolase C/ALDOC cDNA ORF Clone, Human, C-His tag HG11284-CH
Aldolase C/ALDOC cDNA ORF Clone, Human, N-His tag HG11284-NH
Aldolase C/ALDOC cDNA ORF Clone, Human, C-HA tag HG11284-CY
Aldolase C/ALDOC cDNA ORF Clone, Human, N-HA tag HG11284-NY
Aldolase C/ALDOC cDNA ORF Clone, Human, C-Myc tag HG11284-CM
Aldolase C/ALDOC cDNA ORF Clone, Human, N-Myc tag HG11284-NM
Aldolase C/ALDOC qPCR Primer Pairs, Human HP101162
info info
添加购物车成功! 添加购物车失败!