Encomenda rápida

Ratazanao ALDH7A1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag Etiqueta

    Folha de dadosAnálisesProdutos relacionadosProtocolos
    Rato ALDH7A1 Informações sobre o produto de clone de cDNA
    Gene_bank_ref_id:BC012407.1
    Tamanho de cDNA:1536bp
    Descrição de cDNA:Full length Clone DNA of Mus musculus aldehyde dehydrogenase family 7, member A1 with C terminal Flag tag.
    Sinónimo de gene:Atq1, D18Wsu181e
    Espécie:Mouse
    Vetor:pCMV3-C-FLAG
    Plasmid:
    Local de restrição:
    Sequência de etiqueta:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
    Descrição da sequência:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with ALDH7A1 qPCR primers for gene expression analysis, MP202069 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
    FLAG Tag Info

    FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

    The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

    Ratazanao ALDH7A1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag Etiqueta on other vectors
    Ratazanao ALDH7A1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaMG52196-ACG$245
    Ratazanao ALDH7A1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaMG52196-ACR$245
    Ratazanao ALDH7A1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaMG52196-ANG$245
    Ratazanao ALDH7A1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaMG52196-ANR$245
    Ratazanao ALDH7A1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaMG52196-CF$215
    Ratazanao ALDH7A1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaMG52196-CH$215
    Ratazanao ALDH7A1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaMG52196-CM$215
    Ratazanao ALDH7A1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaMG52196-CY$215
    Ratazanao ALDH7A1 clonagem de ADN ou de clonagem do gene (vector de expressão)MG52196-G$75
    Ratazanao ALDH7A1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaMG52196-NF$215
    Ratazanao ALDH7A1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaMG52196-NH$215
    Ratazanao ALDH7A1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaMG52196-NM$215
    Ratazanao ALDH7A1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaMG52196-NY$215
    Ratazanao ALDH7A1 clonagem de ADN ou de clonagem do gene (vector de clonagem)MG52196-UT$215
     Saiba mais sobre vectores de expressão
    Product nameProduct name
    Fundo

    ALDH7A1 (Aldehyde dehydrogenase 7 family, member A1) is a member of subfamily 7 in the aldehyde dehydrogenase family. These enzymes are thought to play a major role in the detoxification of aldehydes generated by alcohol metabolism and lipid peroxidation. Mammalian ALDH7A1 is homologous to plant ALDH7B1 which protects against various forms of stress such as increased salinity, dehydration and treatment with oxidants or pesticides. In mammals, ALDH7A1 is known to play a primary role during lysine catabolism through the NAD+-dependent oxidative conversion of aminoadipate semialdehyde (AASA) to its corresponding carboxylic acid, α-aminoadipic acid. Deleterious mutations in human ALDH7A1 are responsible for pyridoxine-dependent and folinic acid-responsive seizures. ALDH7A1 is a novel aldehyde dehydrogenase expressed in multiple subcellular compartments that protects against hyperosmotic stress by generating osmolytes and metabolizing toxic aldehydes.

    Referências
  • Brocker C, et al. (2011) Aldehyde dehydrogenase 7A1 (ALDH7A1) attenuates reactive aldehyde and oxidative stress induced cytotoxicity. Chem Biol Interact. 191(1-3): 269-77.
  • Brocker C, et al. (2010) Aldehyde dehydrogenase 7A1 (ALDH7A1) is a novel enzyme involved in cellular defense against hyperosmotic stress. J Biol Chem. 285(24): 18452-63.
  • Size / Price
    Catálogo: MG52196-CF
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade
    Acrescentar a carrinhoBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
      Itens recentemente visualizados
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"