Encomenda rápida

Text Size:AAA

Ratazanao AK4 / Adenylate Kinase 4 / AK3L1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Mouse AK4 Informações sobre o produto de clone de cDNA
Tamanho de cDNA:672bp
Descrição de cDNA:Full length Clone DNA of Mus musculus adenylate kinase 4 with N terminal Myc tag.
Sinónimo de gene:Ak3, AK 4, Ak-3, Ak-4, Ak3l1, D4Ertd274e
Local de restrição:
Sequência de etiqueta:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Ratazanao AK4 / Adenylate Kinase 4 / AK3L1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc Etiqueta on other vectors
Ratazanao AK4 / Adenylate Kinase 4 / AK3L1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaMG52601-ACG$225
Ratazanao AK4 / Adenylate Kinase 4 / AK3L1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaMG52601-ACR$225
Ratazanao AK4 / Adenylate Kinase 4 / AK3L1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaMG52601-ANG$225
Ratazanao AK4 / Adenylate Kinase 4 / AK3L1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaMG52601-ANR$225
Ratazanao AK4 / Adenylate Kinase 4 / AK3L1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaMG52601-CF$195
Ratazanao AK4 / Adenylate Kinase 4 / AK3L1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaMG52601-CH$195
Ratazanao AK4 / Adenylate Kinase 4 / AK3L1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaMG52601-CM$195
Ratazanao AK4 / Adenylate Kinase 4 / AK3L1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaMG52601-CY$195
Mouse AK4 Gene cDNA clone plasmidMG52601-G$75
Ratazanao AK4 / Adenylate Kinase 4 / AK3L1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaMG52601-NF$195
Ratazanao AK4 / Adenylate Kinase 4 / AK3L1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaMG52601-NH$195
Ratazanao AK4 / Adenylate Kinase 4 / AK3L1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaMG52601-NM$195
Ratazanao AK4 / Adenylate Kinase 4 / AK3L1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaMG52601-NY$195
Ratazanao AK4 / Adenylate Kinase 4 / AK3L1 clonagem de ADN ou de clonagem do gene (vector de expressão)MG52601-U$75
Ratazanao AK4 / Adenylate Kinase 4 / AK3L1 clonagem de ADN ou de clonagem do gene (vector de clonagem)MG52601-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name

Adenylate kinase isoenzyme 4, mitochondrial, also known as ATP-AMP transphosphorylase, Adenylate kinase 3-like, AK4 and AK3L1, is a member the adenylate kinase family. AK4 / AK3L1 is localized to the mitochondrial matrix. Adenylate kinases regulate the adenine and guanine nucleotide compositions within a cell by catalyzing the reversible transfer of phosphate group among these nucleotides. Five isozymes of adenylate kinase have been identified in vertebrates. Expression of these isozymes is tissue-specific and developmentally regulated. AK4 / AK3L1 catalyzes the reversible transfer of the terminal phosphate group between ATP and AMP. It may also be active with GTP. Adenylate kinase 4 ( AK4 / AK3L1 ) is a unique member with no enzymatic activity in the adenylate kinase (AK) family although it shares high sequence homology with other AKs. It remains unclear what physiological function AK4 might play or why it is enzymatically inactive. AK4 / AK3L1 retains the capability of binding nucleotides. It has a glutamine residue instead of a key arginine residue in the active site well conserved in other AKs. The enzymatically inactive AK4 is a stress responsive protein critical to cell survival and proliferation. AK4 / AK3L1 is likely that the interaction with the mitochondrial inner membrane protein ANT is important for AK4 to exert the protective benefits to cells under stress. AK4 / AK3L1 also acts on the specific mechanism of energy metabolism rather than control of the homeostasis of the ADP pool ubiquitously.

Size / Price
Catálogo: MG52601-NM
Preço de catálogo: 
Preço:      (You Save: )
Disponibilidade2-3 weeks
Bulk Discount RequiryAcrescentar a carrinho
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.