After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Encomenda rápida

Text Size:AAA

Ratazanao Angiotensinogen/SerpinA8 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Mouse AGT Informações sobre o produto de clone de cDNA
Tamanho de cDNA:1449bp
Descrição de cDNA:Full length Clone DNA of Mus musculus angiotensinogen (serpin peptidase inhibitor, clade A, member 8) with C terminal Myc tag.
Sinónimo de gene:AngI, AngII, Aogen, AI265500, Serpina8
Local de restrição:
Sequência de etiqueta:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Ratazanao Angiotensinogen/SerpinA8 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc Etiqueta on other vectors
Ratazanao Angiotensinogen/SerpinA8 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaMG50337-ACG$225
Ratazanao Angiotensinogen/SerpinA8 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaMG50337-ACR$225
Ratazanao Angiotensinogen/SerpinA8 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaMG50337-CF$195
Ratazanao Angiotensinogen/SerpinA8 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaMG50337-CH$195
Ratazanao Angiotensinogen/SerpinA8 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaMG50337-CM$195
Ratazanao Angiotensinogen/SerpinA8 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaMG50337-CY$195
Ratazanao Angiotensinogen/SerpinA8 clonagem de ADN ou de clonagem do gene (vector de expressão)MG50337-G$75
Ratazanao Angiotensinogen/SerpinA8 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaMG50337-NF$195
Ratazanao Angiotensinogen/SerpinA8 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaMG50337-NH$195
Ratazanao Angiotensinogen/SerpinA8 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaMG50337-NM$195
Ratazanao Angiotensinogen/SerpinA8 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaMG50337-NY$195
Ratazanao Angiotensinogen/SerpinA8 clonagem de ADN ou de clonagem do gene (vector de clonagem)MG50337-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name

Angiotensinogen, also known as AGT and SerpinA8, is a member of the serpin family. It is an α-2-globulin that is produced constitutively and released into the circulation mainly by the liver. Angiotensinogen is a essential component of the renin-angiotensin system (RAS) and a potent regulator of blood pressure. Angiotensinogen can be schematically considered to consist of a combination of an angiotensin I (Ang I) function, located at the N-terminal end, and the presence of a serpin (serine protease inhibitor) structure at the opposite end. Angiotensinogen is cleaved into three chains: Angiotensin-1 (Ang I), Angiotensin-2 (Ang II), and Angiotensin-3 (Ang III). Angiotensin-1 is a substrate of ACE (angiotensin converting enzyme) that removes a dipeptide to yield the physiologically active peptide angiotensin-2. Angiotensin-1 and angiotensin-2 can be further processed to generate angiotensin-3, angiotensin-4. Angiotensin 1-7 is cleaved from angiotensin-2 by ACE2. Angiotensin-2 acts directly on vascular smooth muscle as a potent vasoconstrictor, affects cardiac contractility and heart rate through its action on the sympathetic nervous system. Defects in AGT are associated with susceptibility to essential hypertension and renal tubular dysgenesis (RTD). Several serpins (antithrombin, maspin, pigment epithelial-derived factor, and kallistatin) have been recently shown to exert an antiangiogenic activity, suggesting a common mechanism of endothelial cell proliferation and migration. Angiotensinogen/AGT and its renin-cleaved product, des(Ang I)AGT, are also angiogenesis inhibitors, both in vitro and in vivo at concentrations within the range of those observed in plasma. The Angiotensinogen products, that is angiotensin II and possibly angiotensin II-related products, have been found to act locally in modulating adipose tissue growth in an autocrine/paracrine manner. The transient or chronic overexpression of angiotensinogen in adipose tissue favors lipogenesis in adipocytes and leads to a 'vicious' circle whereby adipose tissue development is further increased.

  • Ailhaud G, et al. (2002) Angiotensinogen, adipocyte differentiation and fat mass enlargement. Curr Opin Clin Nutr Metab Care. 5(4): 385-9.
  • Corvol P, et al. (2003) Inhibition of angiogenesis: a new function for angiotensinogen and des(angiotensin I)angiotensinogen. Curr Hypertens Rep. 5(2): 149-54.
  • Size / Price
    Catálogo: MG50337-CM
    Preço de catálogo: 
    Preço:      (You Save: )
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.