After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Encomenda rápida

Ratazanao ACP1 / LMW-PTP clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Mouse ACP1 Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_001110239.1
Tamanho de cDNA:477bp
Descrição de cDNA:Full length Clone DNA of Mus musculus acid phosphatase 1, soluble with C terminal Flag tag.
Sinónimo de gene:Acp-1, LMW-PTP, AI427468, 4632432E04Rik
Espécie:Mouse
Vetor:pCMV3-C-FLAG
Plasmid:
Local de restrição:
Sequência de etiqueta:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Ratazanao ACP1 / LMW-PTP clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag Etiqueta on other vectors
Ratazanao ACP1 / LMW-PTP clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaMG51014-ACG$225
Ratazanao ACP1 / LMW-PTP clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaMG51014-ACR$225
Ratazanao ACP1 / LMW-PTP clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaMG51014-ANG$225
Ratazanao ACP1 / LMW-PTP clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaMG51014-ANR$225
Ratazanao ACP1 / LMW-PTP clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaMG51014-CF$195
Ratazanao ACP1 / LMW-PTP clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaMG51014-CH$195
Ratazanao ACP1 / LMW-PTP clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaMG51014-CM$195
Ratazanao ACP1 / LMW-PTP clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaMG51014-CY$195
Ratazanao ACP1 / LMW-PTP clonagem de ADN ou de clonagem do gene (vector de expressão)MG51014-G$75
Ratazanao ACP1 / LMW-PTP clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaMG51014-NF$195
Ratazanao ACP1 / LMW-PTP clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaMG51014-NH$195
Ratazanao ACP1 / LMW-PTP clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaMG51014-NM$195
Ratazanao ACP1 / LMW-PTP clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaMG51014-NY$195
Ratazanao ACP1 / LMW-PTP clonagem de ADN ou de clonagem do gene (vector de clonagem)MG51014-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
Fundo

The low molecular weight phosphotyrosine phosphatase (LMW-PTP), also known as Acid phosphatase 1 (ACP1), belongs to the low molecular weight phosphotyrosine protein phosphatase family are involved in the regulation of important physiological functions, including stress resistance and synthesis of the polysaccharide capsule. ACP1/LMW-PTP is an enzyme involved in platelet-derived growth factor-induced mitogenesis and cytoskeleton rearrangement. LMW-PTP is able to specifically bind and dephosphorylate activated PDGF receptor, thus modulating PDGF-induced mitogenesis. In vitro, LMW-PTP was found to efficiently dephosphorylate activated FcgammaRIIA and LAT, but not Syk or phospholipase Cgamma2. The overexpression of LMW-PTP inhibited activation of Syk downstream of FcgammaRIIA and reduced intracellular Ca(2+) mobilization. It been demonstrated that LMW-PTP is responsible for FcgammaRIIA dephosphorylation, and is implicated in the down-regulation of cell activation mediated by this ITAM-bearing immunoreceptor. In addition, ACP1 is a highly polymorphic phosphatase that is especially abundant in the central nervous system and is known to be involved in several signal transduction pathways.

Referências
  • Cirri P, et al. (1998) Low molecular weight protein-tyrosine phosphatase tyrosine phosphorylation by c-Src during platelet-derived growth factor-induced mitogenesis correlates with its subcellular targeting. J Biol Chem. 273(49): 32522-7.
  • Chiarugi P, et al. (2002) Insight into the role of low molecular weight phosphotyrosine phosphatase (LMW-PTP) on platelet-derived growth factor receptor (PDGF-r) signaling. LMW-PTP controls PDGF-r kinase activity through TYR-857 dephosphorylation. J Biol Chem. 277(40): 37331-8.
  • Bottini N, et al. (2002) Convulsive disorder and the genetics of signal transduction; a study of a low molecular weight protein tyrosine phosphatase in a pediatric sample. Neurosci Lett. 333(3): 159-62.
  • Musumeci L, et al. (2005) Low-molecular-weight protein tyrosine phosphatases of Bacillus subtilis. J Bacteriol. 187(14): 4945-56.
  • Mancini F, et al. (2007) The low-molecular-weight phosphotyrosine phosphatase is a negative regulator of FcgammaRIIA-mediated cell activation. Blood. 110(6): 1871-8.
  • Size / Price
    Catálogo: MG51014-CF
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
    Imagens
        Itens recentemente visualizados
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"