Encomenda rápida

Ratazanao Acetylcholinesterase clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA Etiqueta

    Folha de dadosAnálisesProdutos relacionadosProtocolos
    Rato ACHE Informações sobre o produto de clone de cDNA
    Tamanho de cDNA:1844bp
    Descrição de cDNA:Full length Clone DNA of Mus musculus acetylcholinesterase with N terminal HA tag.
    Sinónimo de gene:mE1a, mE1b, mE1c, mE1d, mE1e, mE1d', mE1c-long, Ache
    Local de restrição:
    Sequência de etiqueta:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    Descrição da sequência:
    ( We provide with ACHE qPCR primers for gene expression analysis, MP200535 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    Ratazanao Acetylcholinesterase clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA Etiqueta on other vectors
    Product nameProduct name

    Acetylcholinesterase, also known as ACHE, is an enzyme that degrades (through its hydrolytic activity) the neurotransmitter acetylcholine, producing choline and an acetate group. Acetylcholinesterase plays a crucial role in nerve impulse transmission at cholinergic synapses by rapid hydrolysis of the neurotransmitter acetylcholine (ACh). ACHE appears to be a potential therapeutic target at muscle injuries including organophosphate myopathy. It is an externally oriented membrane-bound enzyme and its main physiological role is termination of chemical transmission at cholinergic synapses and secretory organs by rapid hydrolysis of the neurotransmitter acetylcholine (ACh). ACHE plays important roles in the cholinergic system, and its dysregulation is involved in a variety of human diseases. ACHE was significantly down-regulated in the cancerous tissues of 69.2% of hepatocellular carcinoma (HCC) patients, and the low ACHE expression in HCC was correlated with tumor aggressiveness, an elevated risk of postoperative recurrence, and a low survival rate. Both the recombinant ACHE protein and the enhanced expression of ACHE significantly inhibited HCC cell growth in vitro and tumorigenicity in vivo. ACHE as a tumor growth suppressor in regulating cell proliferation, the relevant signaling pathways, and the drug sensitivity of HCC cells. Thus, ACHE is a promising independent prognostic predictor for HCC recurrence and the survival of HCC patients. ACHE is responsible for the hydrolysis of acetylcholine in the nervous system. It is inhibited by organophosphate and carbamate pesticides. However, this enzyme is only slightly inhibited by organophosphorothionates.

  • Zhao Y, et al. (2011) Acetylcholinesterase, a key prognostic predictor for hepatocellular carcinoma, suppresses cell growth and induces chemosensitization. Hepatology. 53(2): 493-503.
  • Roepcke CB, et al. (2010) Analysis of phosphorothionate pesticides using a chloroperoxidase pretreatment and acetylcholinesterase biosensor detection. J Agric Food Chem. 58(15): 8748-56.
  • Zaheer-ul-Haq, et al. (2010) Benchmarking docking and scoring protocol for the identification of potential acetylcholinesterase inhibitors. J Mol Graph Model. 28(8): 870-82.
  • Pegan K, et al. (2010) Acetylcholinesterase is involved in apoptosis in the precursors of human muscle regeneration. Chem Biol Interact. 187(1-3): 96-100.
  • Size / Price
    Catálogo: MG50543-NY
    Preço de catálogo: 
    Preço:      (You Save: )
    Acrescentar a carrinhoBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
      Itens recentemente visualizados
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.