Encomenda rápida

Ratazanao ABHD4 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta

    Folha de dadosAnálisesProdutos relacionadosProtocolos
    Rato ABHD4 Informações sobre o produto de clone de cDNA
    Gene_bank_ref_id:NM_001205181.1
    Tamanho de cDNA:957bp
    Descrição de cDNA:Full length Clone DNA of Mus musculus abhydrolase domain containing 4 with N terminal His tag.
    Sinónimo de gene:Abh4, AI429574, 1110035H23Rik, Abhd4
    Espécie:Mouse
    Vetor:pCMV3-N-His
    Plasmid:
    Local de restrição:
    Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Descrição da sequência:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with ABHD4 qPCR primers for gene expression analysis, MP200722 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    Ratazanao ABHD4 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta on other vectors
    Ratazanao ABHD4 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaMG50747-ACG$225
    Ratazanao ABHD4 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaMG50747-ACR$225
    Ratazanao ABHD4 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaMG50747-ANG$225
    Ratazanao ABHD4 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaMG50747-ANR$225
    Ratazanao ABHD4 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaMG50747-CF$195
    Ratazanao ABHD4 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaMG50747-CH$195
    Ratazanao ABHD4 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaMG50747-CM$195
    Ratazanao ABHD4 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaMG50747-CY$195
    Ratazanao ABHD4 clonagem de ADN ou de clonagem do gene (vector de expressão)MG50747-G$75
    Ratazanao ABHD4 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaMG50747-NF$195
    Ratazanao ABHD4 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaMG50747-NH$195
    Ratazanao ABHD4 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaMG50747-NM$195
    Ratazanao ABHD4 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaMG50747-NY$195
    Ratazanao ABHD4 clonagem de ADN ou de clonagem do gene (vector de clonagem)MG50747-UT$195
     Saiba mais sobre vectores de expressão
    Product nameProduct name
    Fundo

    Abhydrolase domain containing 4 (ABHD4), also known as alpha/beta-hydrolase 4 (ABH4) , or lyso-N-acylphosphatidylethanolamine lipase, which belongs to the ABHD4/ABHD5 subfamily of peptidase S33 family. Abhydrolase domain containing (ABHD) gene was a small group belongs to alpha/beta hydrolase superfamily. Known members of this group are all found to be involved in important biochemical processes and related to various diseases. The alpha/beta-hydrolase 4 (ABH4) is a lysophospholipase/phospholipase B that selectively hydrolyzes N-acyl phosphatidylethanolamines (NAPEs) and lysoNAPEs. ABH4 accepts lysoNAPEs bearing both saturated and polyunsaturated N-acyl chains as substrates and displays a distribution that closely mirrors lysoNAPE-lipase activity in mouse tissues. The existence of an NAPE-PLD-independent route for NAE biosynthesis and suggest that ABH4 plays a role in this metabolic pathway by acting as a (lyso)NAPE-selective lipase.

    Referências
  • Li F, et al. (2009) An unannotated alpha/beta hydrolase superfamily member, ABHD6 differentially expressed among cancer cell lines. Mol Biol Rep. 36(4): 691-6.
  • Simon G.M, et al. (2006) Endocannabinoid biosynthesis proceeding through glycerophospho-N-acyl ethanolamine and a role for alpha/beta hydrolase 4 in this pathway. J. Biol. Chem. 281: 26465-72.
  • Size / Price
    Catálogo: MG50747-NH
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade
    Acrescentar a carrinhoBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
      Itens recentemente visualizados
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"