Encomenda rápida

Text Size:AAA

Ratazanao ABHD4 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Mouse ABHD4 Informações sobre o produto de clone de cDNA
Tamanho de cDNA:957bp
Descrição de cDNA:Full length Clone DNA of Mus musculus abhydrolase domain containing 4 with N terminal His tag.
Sinónimo de gene:Abh4, AI429574, 1110035H23Rik, Abhd4
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Ratazanao ABHD4 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta on other vectors
Ratazanao ABHD4 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaMG50747-ACG$225
Ratazanao ABHD4 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaMG50747-ACR$225
Ratazanao ABHD4 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaMG50747-ANG$225
Ratazanao ABHD4 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaMG50747-ANR$225
Ratazanao ABHD4 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaMG50747-CF$195
Ratazanao ABHD4 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaMG50747-CH$195
Ratazanao ABHD4 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaMG50747-CM$195
Ratazanao ABHD4 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaMG50747-CY$195
Ratazanao ABHD4 clonagem de ADN ou de clonagem do gene (vector de expressão)MG50747-G$75
Ratazanao ABHD4 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaMG50747-NF$195
Ratazanao ABHD4 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaMG50747-NH$195
Ratazanao ABHD4 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaMG50747-NM$195
Ratazanao ABHD4 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaMG50747-NY$195
Ratazanao ABHD4 clonagem de ADN ou de clonagem do gene (vector de clonagem)MG50747-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name

Abhydrolase domain containing 4 (ABHD4), also known as alpha/beta-hydrolase 4 (ABH4) , or lyso-N-acylphosphatidylethanolamine lipase, which belongs to the ABHD4/ABHD5 subfamily of peptidase S33 family. Abhydrolase domain containing (ABHD) gene was a small group belongs to alpha/beta hydrolase superfamily. Known members of this group are all found to be involved in important biochemical processes and related to various diseases. The alpha/beta-hydrolase 4 (ABH4) is a lysophospholipase/phospholipase B that selectively hydrolyzes N-acyl phosphatidylethanolamines (NAPEs) and lysoNAPEs. ABH4 accepts lysoNAPEs bearing both saturated and polyunsaturated N-acyl chains as substrates and displays a distribution that closely mirrors lysoNAPE-lipase activity in mouse tissues. The existence of an NAPE-PLD-independent route for NAE biosynthesis and suggest that ABH4 plays a role in this metabolic pathway by acting as a (lyso)NAPE-selective lipase.

  • Li F, et al. (2009) An unannotated alpha/beta hydrolase superfamily member, ABHD6 differentially expressed among cancer cell lines. Mol Biol Rep. 36(4): 691-6.
  • Simon G.M, et al. (2006) Endocannabinoid biosynthesis proceeding through glycerophospho-N-acyl ethanolamine and a role for alpha/beta hydrolase 4 in this pathway. J. Biol. Chem. 281: 26465-72.
  • Size / Price
    Catálogo: MG50747-NH
    Preço de catálogo: 
    Preço:      (You Save: )
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.