After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Encomenda rápida

Text Size:AAA

MERS-CoV (NCoV / Novel coronavirus) orf5 ORF mammalian expression plasmid, N-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
MERS-CoV CoV-orf5 Informações sobre o produto de clone de cDNA
Tamanho de cDNA:324bp
Descrição de cDNA:Full length Clone DNA of MERS-CoV (NCoV / Novel coronavirus) orf5 with N terminal His tag.
Sinónimo de gene:CoV-orf5
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:Identical with the Gene Bank AFS88940 sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at ambient temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

MERS-CoV (NCoV / Novel coronavirus) orf5 ORF mammalian expression plasmid, N-His Etiqueta on other vectors
MERS-CoV (NCoV / Novel coronavirus) orf5 ORF mammalian expression plasmid, C-GFPSpark EtiquetaVG40086-ACG$325
MERS-CoV (NCoV / Novel coronavirus) orf5 ORF mammalian expression plasmid, C-OFPSpark / RFP EtiquetaVG40086-ACR$325
MERS-CoV (NCoV / Novel coronavirus) orf5 ORF mammalian expression plasmid, N-GFPSpark EtiquetaVG40086-ANG$325
MERS-CoV (NCoV / Novel coronavirus) orf5 ORF mammalian expression plasmid, N-OFPSpark / RFP EtiquetaVG40086-ANR$325
MERS-CoV (NCoV / Novel coronavirus) orf5 ORF mammalian expression plasmid, C-Flag EtiquetaVG40086-CF$295
MERS-CoV (NCoV / Novel coronavirus) orf5 ORF mammalian expression plasmid, C-His EtiquetaVG40086-CH$295
MERS-CoV (NCoV / Novel coronavirus) orf5 ORF mammalian expression plasmid, C-Myc EtiquetaVG40086-CM$295
MERS-CoV (NCoV / Novel coronavirus) orf5 ORF mammalian expression plasmid, C-HA EtiquetaVG40086-CY$295
MERS-CoV (NCoV / Novel coronavirus) orf5 ORF mammalian expression plasmid (Codon Optimized)VG40086-G$95
MERS-CoV (NCoV / Novel coronavirus) orf5 ORF mammalian expression plasmid, N-Flag EtiquetaVG40086-NF$295
MERS-CoV (NCoV / Novel coronavirus) orf5 ORF mammalian expression plasmid, N-His EtiquetaVG40086-NH$295
MERS-CoV (NCoV / Novel coronavirus) orf5 ORF mammalian expression plasmid, N-Myc EtiquetaVG40086-NM$295
MERS-CoV (NCoV / Novel coronavirus) orf5 ORF mammalian expression plasmid, N-HA EtiquetaVG40086-NY$295
MERS-CoV (NCoV / Novel coronavirus) orf5 natural ORF mammalian expression plasmidVG40086-UT$295
 Saiba mais sobre vectores de expressão
Product nameProduct name
Size / Price
Catálogo: VG40086-NH
Preço de catálogo: 
Preço:      (You Save: )
Disponibilidade2-3 weeks
Bulk Discount RequiryAcrescentar a carrinho
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.