Encomenda rápida

MERS-CoV (NCoV / Novel coronavirus) orf4b ORF mammalian expression plasmid, N-His Etiqueta

    Folha de dadosAnálisesProdutos relacionadosProtocolos
    MERS-CoV CoV-orf4b Informações sobre o produto de clone de cDNA
    Gene_bank_ref_id:JX869059.2
    Tamanho de cDNA:741bp
    Descrição de cDNA:Full length Clone DNA of MERS-CoV (NCoV / Novel coronavirus) orf4b with N terminal His tag.
    Sinónimo de gene:CoV-orf4b
    Espécie:MERS-CoV
    Vetor:pCMV3-N-His
    Plasmid:
    Local de restrição:
    Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Descrição da sequência:Identical with the Gene Bank AFS88939.1.
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Armazenamento:The lyophilized plasmid can be stored at ambient temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    MERS-CoV (NCoV / Novel coronavirus) orf4b ORF mammalian expression plasmid, N-His Etiqueta on other vectors
    MERS-CoV (NCoV / Novel coronavirus) orf4b ORF mammalian expression plasmid, C-GFPSpark EtiquetaVG40084-ACG$325
    MERS-CoV (NCoV / Novel coronavirus) orf4b ORF mammalian expression plasmid, C-OFPSpark / RFP EtiquetaVG40084-ACR$325
    MERS-CoV (NCoV / Novel coronavirus) orf4b ORF mammalian expression plasmid, N-GFPSpark EtiquetaVG40084-ANG$325
    MERS-CoV (NCoV / Novel coronavirus) orf4b ORF mammalian expression plasmid, N-OFPSpark / RFP EtiquetaVG40084-ANR$325
    MERS-CoV (NCoV / Novel coronavirus) orf4b ORF mammalian expression plasmid, C-Flag EtiquetaVG40084-CF$295
    MERS-CoV (NCoV / Novel coronavirus) orf4b ORF mammalian expression plasmid, C-His EtiquetaVG40084-CH$295
    MERS-CoV (NCoV / Novel coronavirus) orf4b ORF mammalian expression plasmid, C-Myc EtiquetaVG40084-CM$295
    MERS-CoV (NCoV / Novel coronavirus) orf4b ORF mammalian expression plasmid, C-HA EtiquetaVG40084-CY$295
    MERS-CoV (NCoV / Novel coronavirus) orf4b ORF mammalian expression plasmid (Codon Optimized)VG40084-G$95
    MERS-CoV (NCoV / Novel coronavirus) orf4b ORF mammalian expression plasmid, N-Flag EtiquetaVG40084-NF$295
    MERS-CoV (NCoV / Novel coronavirus) orf4b ORF mammalian expression plasmid, N-His EtiquetaVG40084-NH$295
    MERS-CoV (NCoV / Novel coronavirus) orf4b ORF mammalian expression plasmid, N-Myc EtiquetaVG40084-NM$295
    MERS-CoV (NCoV / Novel coronavirus) orf4b ORF mammalian expression plasmid, N-HA EtiquetaVG40084-NY$295
    MERS-CoV (NCoV / Novel coronavirus) orf4b natural ORF mammalian expression plasmidVG40084-UT$295
     Saiba mais sobre vectores de expressão
    Product nameProduct name
    Size / Price
    Catálogo: VG40084-NH
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade
    Acrescentar a carrinhoBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
      Itens recentemente visualizados
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"