After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Encomenda rápida

Text Size:AAA

Humano MD1 / MMD-1 / LY86 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human LY86 Informações sobre o produto de clone de cDNA
Tamanho de cDNA:489bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens lymphocyte antigen 86 with Flag tag.
Sinónimo de gene:LY86, MD-1, MMD-1, dJ80N2.1, RP1-80N2.1
Local de restrição:KpnI + XhoI (5.4kb + 0.54kb)
Sequência de etiqueta:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Descrição da sequência:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
pCMV2-FLAG Vector Information
Vector Name pCMV2-FLAG
Vector Size 5592bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV2-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Humano MD1 / MMD-1 / LY86 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag Etiqueta on other vectors
Humano MD1 / MMD-1 / LY86 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG10242-ACG$225
Humano MD1 / MMD-1 / LY86 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG10242-ACR$225
Humano MD1 / MMD-1 / LY86 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG10242-CF$195
Humano MD1 / MMD-1 / LY86 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG10242-CH$195
Humano MD1 / MMD-1 / LY86 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG10242-CM$195
Humano MD1 / MMD-1 / LY86 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG10242-CY$195
Humano MD1 / MMD-1 / LY86 clonagem de ADN ou de clonagem do gene (vector de expressão)HG10242-M$75
Humano MD1 / MMD-1 / LY86 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG10242-M-F$195
Humano MD1 / MMD-1 / LY86 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG10242-NF$195
Humano MD1 / MMD-1 / LY86 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG10242-NH$195
Humano MD1 / MMD-1 / LY86 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG10242-NM$195
Humano MD1 / MMD-1 / LY86 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG10242-NY$195
Humano MD1 / MMD-1 / LY86 clonagem de ADN ou de clonagem do gene (vector de clonagem)HG10242-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name

MD-1 and MD-2 are secretory glycoproteins that exist on the cell surface in complexes with transmembrane proteins. MD-1 is anchored by radioprotective 105 (RP105) which is a molecule containing leucine-rich repeats and is expressed on B cells, dentritic cells and macrophages, while MD-2 is associated with TLR4. MD-1 is required for efficient RP105 cell surface expression and function. It is indicated that the RP105/MD1 complex, in conjunction with TLR4, mediates the innate immune response to LPS in B cells, and also plays a role in protecting against apoptosis, B-cell proliferation, etc. Mouse MD-1 cDNA encodes a 162 amino acid precursor protein with a putative 19 aa signal peptide and two potential N-linked glycosylation sites. It shares 40% and 66% amino acid sequence identity with chicken and human MD-1 respectively. MD-1 is mainly expressed in spleen, and also detectable in liver, brain, thymus, and kidney.

Size / Price
Catálogo: HG10242-M-F
Preço de catálogo: 
Preço:      (You Save: )
DisponibilidadeIn Stock
Bulk Discount RequiryAcrescentar a carrinho
Contact Us
      Itens recentemente visualizados
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.