Encomenda rápida

Text Size:AAA

Gripe A H8N4 (A/pintail duck/Alberta/114/1979) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
H8N4 HA Informações sobre o produto de clone de cDNA
Tamanho de cDNA:1701bp
Descrição de cDNA:Full length Clone DNA of Influenza A H8N4 (A/pintail duck/Alberta/114/1979) HA with N terminal His tag.
Sinónimo de gene:HA1, Hemagglutinin
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:A number of silent mutations were introduced into the DNA sequence in order to increase its protein expression level in mammalian cell system. The translated amino acid sequence is identical with ABB87729.1.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at ambient temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Gripe A H8N4 (A/pintail duck/Alberta/114/1979) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-His Etiqueta on other vectors
Gripe A H8N4 (A/pintail duck/Alberta/114/1979) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized), C-GFPSpark-taggedVG11722-ACG$345
Gripe A H8N4 (A/pintail duck/Alberta/114/1979) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-OFPSpark / RFP EtiquetaVG11722-ACR$345
Gripe A H8N4 (A/pintail duck/Alberta/114/1979) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized)VG11722-C$315
Gripe A H8N4 (A/pintail duck/Alberta/114/1979) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized), C-Flag EtiquetaVG11722-CF$315
Gripe A H8N4 (A/pintail duck/Alberta/114/1979) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-His EtiquetaVG11722-CH$315
Gripe A H8N4 (A/pintail duck/Alberta/114/1979) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-Myc EtiquetaVG11722-CM$315
Gripe A H8N4 (A/pintail duck/Alberta/114/1979) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-HA EtiquetaVG11722-CY$315
Gripe A H8N4 (A/pintail duck/Alberta/114/1979) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-Flag EtiquetaVG11722-NF$315
Gripe A H8N4 (A/pintail duck/Alberta/114/1979) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-His EtiquetaVG11722-NH$315
Gripe A H8N4 (A/pintail duck/Alberta/114/1979) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized), N-Myc-taggedVG11722-NM$315
Gripe A H8N4 (A/pintail duck/Alberta/114/1979) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-HA EtiquetaVG11722-NY$315
Gripe A H8N4 (A/pintail duck/Alberta/114/1979) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized)VG11722-UT$315
 Saiba mais sobre vectores de expressão
Product nameProduct name
Size / Price
Catálogo: VG11722-NH
Preço de catálogo: 
Preço:      (You Save: )
Disponibilidade2-3 weeks
Bulk Discount RequiryAcrescentar a carrinho
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.