Influenza A H5N1 (Cambodia/S1211394/2008) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, C-HA tag

Cat: VG40026-CY

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All Hemagglutinin / HA Reagents

CRO Services

Product recommended


All Hemagglutinin / HA Reagents

Influenza A H5N1 (Cambodia/S1211394/2008) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, C-HA tag General Information

Gene

Species
H5N1
RefSeq ORF Size
1707 bp
Sequence Description
A number of silent mutations were introduced into the DNA sequence in order to increase its protein expression level in mammalian cell system. The translated amino acid sequence is identical with ADM95445.1.
Description
Full length Clone DNA of Influenza A H5N1 (A/Cambodia/S1211394/2008) Hemagglutinin with C terminal HA tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Hemagglutinin / HA Background Information

The influenza viral Hemagglutinin (HA) protein is a homo trimer with a receptor binding pocket on the globular head of each monomer.HA has at least 18 different antigens. These subtypes are named H1 through H18.HA has two functions. Firstly, it allows the recognition of target vertebrate cells, accomplished through the binding to these cells' sialic acid-containing receptors. Secondly, once bound it facilitates the entry of the viral genome into the target cells by causing the fusion of host endosomal membrane with the viral membrane.The influenza virus Hemagglutinin (HA) protein is translated in cells as a single protein, HA, or hemagglutinin precursor protein. For viral activation, hemagglutinin precursor protein (HA) must be cleaved by a trypsin-like serine endoprotease at a specific site, normally coded for by a single basic amino acid (usually arginine) between the HA1 and HA2 domains of the protein. After cleavage, the two disulfide-bonded protein domains produce the mature form of the protein subunits as a prerequisite for the conformational change necessary for fusion and hence viral infectivity.
Full Name
Harvey rat sarcoma viral oncogene homolog
References
  • White JM, Hoffman LR, Arevalo JH, et al. (1997). ""Attachment and entry of influenza virus into host cells. Pivotal roles of hemagglutinin"". In Chiu W, Burnett RM, Garcea RL. Structural Biology of Viruses.
  • Suzuki Y (March 2005). ""Sialobiology of influenza: molecular mechanism of host range variation of influenza viruses"". Biol. Pharm. Bull. 28 (3): 399–408.
  • Senne DA, Panigrahy B, Kawaoka Y, et al. (1996). ""Survey of the hemagglutinin (HA) cleavage site sequence of H5 and H7 avian influenza viruses: amino acid sequence at the HA cleavage site as a marker of pathogenicity potential"". Avian Dis. 40 (2): 425–37
  • Hemagglutinin / HA cDNA ORF Clone, H17N10, Related Products

    Product Name Catalog#(PDF)
    Influenza A H17N10 (A/little yellow-shouldered bat/Guatemala/164/2009) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized) VG40323-G
    Influenza A H17N10 (A/little yellow-shouldered bat/Guatemala/164/2009) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, C-GFPSpark tag VG40323-ACG
    Influenza A H17N10 (A/little yellow-shouldered bat/Guatemala/164/2009) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, C-OFPSpark / RFP tag VG40323-ACR
    Influenza A H17N10 (little yellow-shouldered bat/Guatemala/164/2009) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, C-HA tag VG40323-CY

    Hemagglutinin / HA cDNA ORF Clone, H1N1, Related Products

    Product Name Catalog#(PDF)
    Influenza A H1N1 (A/Brisbane/59/2007) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized) VG11052-UT
    Influenza A H1N1 (A/Texas/36/1991) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized) VG40132-UT
    Influenza A H1N1 (England/195/2009) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized) VG40005-UT
    Influenza A H1N1 (A/Ohio/UR06-0091/2007) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized) VG11687-C
    Influenza A H1N1 (A/Bel/1942) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized) VG40506-UT
    Influenza A H1N1 (A/Christchurch/16/2010) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized) VG40516-UT
    Influenza A H1N1 (A/New York/06/2009) Hemagglutinin / HA Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag(Codon Optimized) VG40434-ACGLN
    Influenza A H1N1 (A/Albany/12/1951) Hemagglutinin / HA Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag(Codon Optimized) VG40464-ACGLN
    Influenza A H1N1 (A/New Caledonia/20/99) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized), C-GFPSpark-tagged VG11683-ACG
    Influenza A H1N1 (A/Ohio/07/2009) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, C-OFPSpark / RFP tag VG40007-ACR
    Influenza A H1N1 (A/swine/Belgium/1/1998) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, C-OFPSpark / RFP tag VG40393-ACR
    Influenza A H1N1 (A/WSN/33) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-OFPSpark / RFP tag VG11692-ACR
    Influenza A H1N1 (Beijing/22808/2009) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized), C-Flag tag VG40035-CF
    Influenza A H1N1 (A/NewJersey/8/1976) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, C-Flag tag VG40392-CF
    Influenza A H1N1 (A/Solomon Islands/3/2006) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized), C-Flag tag VG11708-CF
    Influenza A H1N1 (A/swine/Belgium/1/1998) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, N-Flag tag VG40393-NF
    Influenza A H1N1 (New York/18/2009) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, N-Flag tag VG40009-NF
    Influenza A H1N1 (England/195/2009) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, N-Flag tag VG40005-NF
    Influenza A H1N1 (A/Ohio/UR06-0091/2007) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-His tag VG11687-CH
    Influenza A H1N1 (Beijing/22808/2009) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, C-His tag VG40035-CH
    Influenza A H1N1 (A/WSN/33) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-His tag VG11692-CH
    Influenza A H1N1 (A/California/07/2009) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized), C-His tag VG11085-CH
    Influenza A H1N1 (A/New Caledonia/20/99) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-His tag VG11683-CH
    Influenza A H1N1 (New York/18/2009) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, C-His tag VG40009-CH
    Influenza A H1N1 (England/195/2009) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, N-His tag VG40005-NH
    Influenza A H1N1 (New York/18/2009) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, N-His tag VG40009-NH
    Influenza A H1N1 (Beijing/22808/2009) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, N-His tag VG40035-NH
    Influenza A H1N1 (A/Puerto Rico/8/1934) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-HA tag VG11684-CY
    Influenza A H1N1 (A/WSN/33) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-HA tag VG11692-CY
    Influenza A H1N1 (Texas/05/2009) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, C-HA tag VG40006-CY
    Influenza A H1N1 (A/Solomon Islands/3/2006) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-HA tag VG11708-CY
    Influenza A H1N1 (England/195/2009) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, C-HA tag VG40005-CY
    Influenza A H1N1 (A/swine/Belgium/1/1998) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, C-HA tag VG40393-CY
    Influenza A H1N1 (A/NewJersey/8/1976) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, N-HA tag VG40392-NY
    Influenza A H1N1 (New York/18/2009) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, N-HA tag VG40009-NY
    Influenza A H1N1 (A/Swine/Wisconsin/136/1997) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, N-HA tag VG40394-NY
    Influenza A H1N1 (Ohio/07/2009) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, C-Myc tag VG40007-CM
    Influenza A H1N1 (A/New Caledonia/20/99) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-Myc tag VG11683-CM
    Influenza A H1N1 (A/swine/Belgium/1/1998) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, C-Myc tag VG40393-CM
    Influenza A H1N1 (Beijing/22808/2009) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized), N-Myc-tagged VG40035-NM
    Influenza A H1N1 (A/Solomon Islands/3/2006) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized), N-Myc-tagged VG11708-NM
    Influenza A H1N1 (A/NewJersey/8/1976) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, N-Myc tag VG40392-NM

    Hemagglutinin / HA cDNA ORF Clone, H4N2, Related Products

    Product Name Catalog#(PDF)
    Influenza A H4N2 (A/duck/Hunan/8-19/2009) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized) VG40390-UT
    Influenza A H4N2 (A/duck/Hunan/8-19/2009) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, C-OFPSpark / RFP tag VG40390-ACR
    Influenza A H4N2 (A/duck/Hunan/8-19/2009) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, C-Flag tag VG40390-CF
    Influenza A H4N2 (A/duck/Hunan/8-19/2009) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, C-His tag VG40390-CH

    Hemagglutinin / HA cDNA ORF Clone, Influenza B, Related Products

    Product Name Catalog#(PDF)
    Influenza B (B/Victoria/504/2000) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized) VG40391-UT
    Influenza B (Brisbane/60/2008) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized) VG40016-UT
    Influenza B (B/Brisbane/3/2007) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized) VG40431-G-N
    Influenza B (B/Hong Kong/259/2010) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized) VG40504-G-N
    Influenza B (B/Brisbane/60/2008) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized), C-GFPSpark-tagged VG40016-ACG
    Influenza B (B/Victoria/504/2000) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, C-Flag tag VG40391-CF
    Influenza B (Brisbane/60/2008) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, C-His tag VG40016-CH
    Influenza B (B/Malaysia/2506/2004) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-His tag VG11716-NH
    Influenza B (B/Malaysia/2506/2004) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-HA tag VG11716-NY
    Influenza B (B/Malaysia/2506/2004) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-Myc tag VG11716-CM
    Influenza B (B/Victoria/504/2000) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, N-Myc tag VG40391-NM

    Hemagglutinin / HA cDNA ORF Clone, H11N9, Related Products

    Product Name Catalog#(PDF)
    Influenza A H11N9 (A/environment/Jiangxi/28/2009) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized) VG40382-UT
    Influenza A H11N9 (A/mallard/Alberta/294/1977) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized), C-Flag tag VG11704-CF
    Influenza A H11N9 (A/mallard/Alberta/294/1977) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized), N-Myc-tagged VG11704-NM

    Hemagglutinin / HA cDNA ORF Clone, H10N8, Related Products

    Product Name Catalog#(PDF)
    Influenza A H10N8 (A/Jiangxi-Donghu/346/2013) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized) VG40359-G-N
    Influenza A H10N8 (A/duck/Guangdong/E1/2012) Hemagglutinin / HA Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag(Codon Optimized) VG40351-ACGLN
    Influenza A H10N8 (A/Jiangxi-Donghu/346/2013) Hemagglutinin / HA Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag(Codon Optimized) VG40359-ACGLN

    Hemagglutinin / HA cDNA ORF Clone, H7N9, Related Products

    Product Name Catalog#(PDF)
    Influenza A H7N9 (A/Huzhou/10/2013) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized) VG40356-G-N
    Influenza A H7N9 (A/Shanghai/1/2013) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized) VG40104-UT
    Influenza A H7N9 (A/Anhui/1/2013) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized), C-Flag tag VG40103-CF
    Influenza A H7N9 (A/Anhui/1/2013) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-Flag tag VG40103-NF
    Influenza A H7N9 (A/Anhui/1/2013) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-HA tag VG40103-NY
    Influenza A H7N9 (A/Shanghai/1/2013) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized), C-Myc tag VG40104-CM
    Influenza A H7N9 (A/Anhui/1/2013) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-Myc tag VG40103-NM

    Hemagglutinin / HA cDNA ORF Clone, H9N8, Related Products

    Product Name Catalog#(PDF)
    Influenza A H9N8 (A/chicken/Korea/164/04) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized) VG40183-G-N

    Hemagglutinin / HA cDNA ORF Clone, H7N7, Related Products

    Product Name Catalog#(PDF)
    Influenza A H7N7 (A/equine/Kentucky/1a/1975) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized) VG40171-UT

    Hemagglutinin / HA cDNA ORF Clone, H6N2, Related Products

    Product Name Catalog#(PDF)
    Influenza A H6N2 (A/chicken/Guangdong/C273/2011) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized) VG40398-UT
    Influenza A H6N2 (A/chicken/Guangdong/C273/2011) Hemagglutinin / HA Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag(Codon Optimized) VG40398-ACGLN
    Influenza A H6N2 (A/chicken/Guangdong/C273/2011) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, N-His tag VG40398-NH
    Influenza A H6N2 (A/chicken/Guangdong/C273/2011) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, C-HA tag VG40398-CY

    Hemagglutinin / HA cDNA ORF Clone, H3N2, Related Products

    Product Name Catalog#(PDF)
    Influenza A H3N2 (A/Babol/36/2005) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized) VG40153-UT
    Influenza A H3N2 (A/Victoria/361/2011) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized) VG40145-UT
    Influenza A H3N2 (A/Wisconsin/67/2005) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized) VG11972-UT
    Influenza A H3N2 (A/Sydney/5/97) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized) VG40149-UT
    Influenza A H3N2 (A/Panama/2007/1999) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized) VG40484-UT
    Influenza A H3N2 (A/Fujian/411/2002) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized) VG40488-UT
    Influenza A H3N2 (A/Brisbane/10/2007) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized) VG11056-UT
    Influenza A H3N2 (A/Hanoi/EL134/2008) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized) VG40489-UT
    Influenza A H3N2 (A/Wisconsin/67/2005) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized), C-GFPSpark-tagged VG11972-ACG
    Influenza A H3N2 (A/England/42/1972 ) Hemagglutinin / HA Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag(Codon Optimized) VG40479-ACGLN
    Influenza A H3N2 (A/Victoria/3/1975) Hemagglutinin / HA Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag(Codon Optimized) VG40396-ACGLN
    Influenza A H3N2 (A/Brisbane/10/2007) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized), C-OFPSpark / RFP-tagged VG11056-ACR
    Influenza A H3N2 (A/Brisbane/10/2007) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized), C-Flag tag VG11056-CF
    Influenza A H3N2 (A/Hong Kong/1/1968) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized), C-Flag tag VG40116-CF
    Influenza A H3N2 (A/Hong Kong/1/1968) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-Flag tag VG40116-NF
    Influenza A H3N2 (A/Brisbane/10/2007) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-Flag tag VG11056-NF
    Influenza A H3N2 (A/Wisconsin/67/2005) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-His tag VG11972-NH
    Influenza A H3N2 (A/Victoria/3/1975) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, C-HA tag VG40396-CY
    Influenza A H3N2 (A/Brisbane/10/2007) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-Myc tag VG11056-CM
    Influenza A H3N2 (A/Indiana/07/2012) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, C-Myc tag VG40395-CM
    Influenza A H3N2 (A/Wisconsin/67/2005) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized), N-Myc-tagged VG11972-NM
    Influenza A H3N2 (A/Indiana/07/2012) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, N-Myc tag VG40395-NM

    Hemagglutinin / HA cDNA ORF Clone, H5N1, Related Products

    Product Name Catalog#(PDF)
    Influenza A H5N1 (A/chicken/VietNam/NCVD-016/2008) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized) VG40158-G-N
    Influenza A H5N1 (Egypt/3300-NAMRU3/2008) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized) VG40049-UT
    Influenza A H5N1 (A/goose/Guiyang/337/2006) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized) VG11690-UT
    Influenza A H5N1 (Anhui/1/2005) Hemagglutinin / HA natural ORF mammalian expression plasmid VG11048-UT
    Influenza A H5N1 (A/chicken/Jilin/9/2004) Hemagglutinin / HA Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag(Codon Optimized) VG40372-ACGLN
    Influenza A H5N1 (A/whooper swan/Mongolia/244/2005) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized), C-GFPSpark-tagged VG11709-ACG
    Influenza A H5N1 (A/chicken/Yamaguchi/7/2004) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized), C-GFPSpark-tagged VG40088-ACG
    Influenza A H5N1 (A/Egypt/2321-NAMRU3/2007) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized), C-GFPSpark-tagged VG11697-ACG
    Influenza A H5N1 (A/Hubei/1/2010) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, C-OFPSpark / RFP tag VG40060-ACR
    Influenza A H5N1 (A/goose/Guiyang/337/2006) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-OFPSpark / RFP tag VG11690-ACR
    Influenza A H5N1 (Cambodia/S1211394/2008) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized), C-Flag tag VG40026-CF
    Influenza A H5N1 (A/duck/Hunan/795/2002) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized), C-Flag tag VG11698-CF
    Influenza A H5N1 (A/Egypt/2321-NAMRU3/2007) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized), C-Flag tag VG11697-CF
    Influenza A H5N1 (A/chicken/Egypt/2253-1/2006) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized), C-Flag tag VG11686-CF
    Influenza A H5N1 (A/Hong Kong/483/97) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized), C-Flag tag VG11689-CF
    Influenza A H5N1 (Hubei/1/2010) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, N-Flag tag VG40060-NF
    Influenza A H5N1 (A/duck/Hunan/795/2002) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-Flag tag VG11698-NF
    Influenza A H5N1 (Cambodia/S1211394/2008) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, N-Flag tag VG40026-NF
    Influenza A H5N1 (A/duck/Laos/3295/2006) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-Flag tag VG11701-NF
    Influenza A H5N1 (A/duck/Laos/3295/2006) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-His tag VG11701-CH
    Influenza A H5N1 (Cambodia/S1211394/2008) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, C-His tag VG40026-CH
    Influenza A H5N1 (A/Egypt/2321-NAMRU3/2007) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-His tag VG11697-NH
    Influenza A H5N1 (Hubei/1/2010) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, N-His tag VG40060-NH
    Influenza A H5N1 (A/Japanese white-eye/Hong Kong/1038/2006) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-His tag VG11694-NH
    Influenza A H5N1 (Hubei/1/2010) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, C-HA tag VG40060-CY
    Influenza A H5N1 (chicken/Yamaguchi/7/2004) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, C-HA tag VG40088-CY
    Influenza A H5N1 (A/Hong Kong/483/97) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-HA tag VG11689-CY
    Influenza A H5N1 (bar-headed goose/Qinghai/1A/2005) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, C-HA tag VG40117-CY
    Influenza A H5N1 (A/duck/Laos/3295/2006) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-HA tag VG11701-NY
    Influenza A H5N1 (A/Egypt/2321-NAMRU3/2007) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-HA tag VG11697-NY
    Influenza A H5N1 (A/duck/Hunan/795/2002) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-Myc tag VG11698-CM
    Influenza A H5N1 (Thailand/1(KAN-1)/2004) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, C-Myc tag VG40065-CM
    Influenza A H5N1 (A/Japanese white-eye/Hong Kong/1038/2006) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-Myc tag VG11694-CM
    Influenza A H5N1 (Thailand/1(KAN-1)/2004) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized), N-Myc-tagged VG40065-NM
    Influenza A H5N1 (A/duck/Hunan/795/2002) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized), N-Myc-tagged VG11698-NM
    Influenza A H5N1 (A/Vietnam/1194/2004) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized), N-Myc tag VG11062-NM
    Influenza A H5N1 (A/whooper swan/Mongolia/244/2005) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized), N-Myc-tagged VG11709-NM
    Influenza A H5N1 (Egypt/3300-NAMRU3/2008) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized), N-Myc-tagged VG40049-NM
    Influenza A H5N1 (Cambodia/S1211394/2008) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized), N-Myc-tagged VG40026-NM

    Hemagglutinin / HA cDNA ORF Clone, H7N1, Related Products

    Product Name Catalog#(PDF)
    Influenza A H7N1 (A/turkey/Italy/4602/99) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized) VG40169-G-N

    Hemagglutinin / HA cDNA ORF Clone, H16N3, Related Products

    Product Name Catalog#(PDF)
    Influenza A H16N3 (A/black-headed gull/Sweden/5/99) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized) VG11711-UT

    Hemagglutinin / HA cDNA ORF Clone, H6N6, Related Products

    Product Name Catalog#(PDF)
    Influenza A H6N6 (A/duck/Eastern China/11/2009) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized) VG40399-UT
    Influenza A H6N6 (A/duck/Eastern China/11/2009) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized), C-GFPSpark tag VG40399-ACG
    Influenza A H6N6 (A/duck/Eastern China/11/2009) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, N-HA tag VG40399-NY

    Hemagglutinin / HA cDNA ORF Clone, H11N2, Related Products

    Product Name Catalog#(PDF)
    Influenza A H11N2 (A/duck/Yangzhou/906/2002) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized) VG11705-UT
    Influenza A H11N2 (A/duck/Yangzhou/906/2002) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized), C-Flag tag VG11705-CF
    Influenza A H11N2 (A/duck/Yangzhou/906/2002) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-HA tag VG11705-NY

    Hemagglutinin / HA cDNA ORF Clone, H15N8, Related Products

    Product Name Catalog#(PDF)
    Influenza A H15N8 (A/duck/AUS/341/1983) Hemagglutinin Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag(Codon Optimized) VG11720-ACGLN

    Hemagglutinin / HA cDNA ORF Clone, H12N5, Related Products

    Product Name Catalog#(PDF)
    Influenza A H12N5 (A/green-winged teal/ALB/199/1991 ) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized), C-GFPSpark-tagged VG11718-ACG
    Influenza A H12N5 (A/green-winged teal/ALB/199/1991 ) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized), C-Flag tag VG11718-CF
    Influenza A H12N5 (A/green-winged teal/ALB/199/1991 ) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-His tag VG11718-CH
    Influenza A H12N5 (A/green-winged teal/ALB/199/1991 ) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized), N-Myc-tagged VG11718-NM

    Hemagglutinin / HA cDNA ORF Clone, H5N8, Related Products

    Product Name Catalog#(PDF)
    Influenza A H5N8 (A/broiler duck/Korea/Buan2/2014(Buan2)) Hemagglutinin / HA Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag(Codon Optimized) VG40384-ACGLN
    Influenza A H5N8 (A/breeder duck/Korea/Gochang1/2014 (Gochang1)) Hemagglutinin / HA Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag(Codon Optimized) VG40383-ACGLN
    Influenza A H5N8 (A/duck/NY/191255-59/02) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized), C-Flag tag VG11717-CF
    Influenza A H5N8 (A/duck/NY/191255-59/02) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-Flag tag VG11717-NF
    Influenza A H5N8 (A/duck/NY/191255-59/02) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-His tag VG11717-CH
    Influenza A H5N8 (A/duck/NY/191255-59/02) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-His tag VG11717-NH
    Influenza A H5N8 (A/duck/NY/191255-59/02) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-HA tag VG11717-NY
    Influenza A H5N8 (A/duck/NY/191255-59/02) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-Myc tag VG11717-CM

    Hemagglutinin / HA cDNA ORF Clone, H6N1, Related Products

    Product Name Catalog#(PDF)
    Influenza A H6N1 (A/quail/Hong Kong/1721-30/99) Hemagglutinin / HA Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag(Codon Optimized) VG40397-ACGLN
    Influenza A H6N1 (A/quail/Hong Kong/1721-30/99) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized), C-GFPSpark tag VG40397-ACG
    Influenza A H6N1 (A/northern shoveler/California/HKWF115/07) Hemagglutinin Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag(Codon Optimized) VG11723-ACGLN
    Influenza A H6N1 (A/northern shoveler/California/HKWF115/07) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-Myc tag VG11723-CM
    Influenza A H6N1 (A/quail/Hong Kong/1721-30/99) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, N-Myc tag VG40397-NM

    Hemagglutinin / HA cDNA ORF Clone, H9N2, Related Products

    Product Name Catalog#(PDF)
    Influenza A H9N2 (A/Hong Kong/3239/2008) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized), C-GFPSpark-tagged VG40178-ACG
    Influenza A H9N2 (A/Hong Kong/3239/2008) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, C-OFPSpark / RFP tag VG40178-ACR
    Influenza A H9N2 (A/Guinea fowl/Hong Kong/WF10/99) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-Flag tag VG11719-NF
    Influenza A H9N2 (A/Guinea fowl/Hong Kong/WF10/99) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-HA tag VG11719-CY
    Influenza A H9N2 (A/Guinea fowl/Hong Kong/WF10/99) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-HA tag VG11719-NY

    Hemagglutinin / HA cDNA ORF Clone, H5N2, Related Products

    Product Name Catalog#(PDF)
    Influenza A H5N2 (A/American green-winged teal/California/HKWF609/2007) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized), C-GFPSpark-tagged VG11699-ACG
    Influenza A H5N2 (A/American green-winged teal/California/HKWF609/07) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-Flag tag VG11699-NF
    Influenza A H5N2 (A/American green-winged teal/California/HKWF609/07) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-HA tag VG11699-CY
    Influenza A H5N2 (A/American green-winged teal/California/HKWF609/07) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-HA tag VG11699-NY
    Influenza A H5N2 (A/American green-winged teal/California/HKWF609/07) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized), N-Myc-tagged VG11699-NM

    Hemagglutinin / HA cDNA ORF Clone, H13N8, Related Products

    Product Name Catalog#(PDF)
    Influenza A H13N8 (A/black-headed gull/Netherlands/1/00) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-OFPSpark / RFP tag VG11721-ACR
    Influenza A H13N8 (A/black-headed gull/Netherlands/1/00) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-HA tag VG11721-NY

    Hemagglutinin / HA cDNA ORF Clone, H4N8, Related Products

    Product Name Catalog#(PDF)
    Influenza A H4N8 (A/chicken/Alabama/1/1975) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, C-OFPSpark / RFP tag VG40025-ACR
    Influenza A H4N8 (chicken/Alabama/1/1975) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, N-Flag tag VG40025-NF

    Hemagglutinin / HA cDNA ORF Clone, H1N2, Related Products

    Product Name Catalog#(PDF)
    Influenza A H1N2 (A/swine/Guangxi/13/2006) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-OFPSpark / RFP tag VG11703-ACR
    Influenza A H1N2 (A/swine/Guangxi/13/2006) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-His tag VG11703-NH
    Influenza A H1N2 (A/swine/Guangxi/13/2006) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized), N-Myc-tagged VG11703-NM

    Hemagglutinin / HA cDNA ORF Clone, H1N3, Related Products

    Product Name Catalog#(PDF)
    Influenza A H1N3 (A/duck/NZL/160/1976) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized), C-Flag tag VG11685-CF
    Influenza A H1N3 (A/duck/NZL/160/1976) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-HA tag VG11685-CY

    Hemagglutinin / HA cDNA ORF Clone, H10N3, Related Products

    Product Name Catalog#(PDF)
    Influenza A H10N3 (A/duck/Hong Kong/786/1979) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized), C-Flag tag VG11693-CF
    Influenza A H10N3 (A/duck/Hong Kong/786/1979) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-Flag tag VG11693-NF
    Influenza A H10N3 (A/duck/Hong Kong/786/1979) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-His tag VG11693-NH
    Influenza A H10N3 (A/duck/Hong Kong/786/1979) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized), N-Myc-tagged VG11693-NM

    Hemagglutinin / HA cDNA ORF Clone, H2N2, Related Products

    Product Name Catalog#(PDF)
    Influenza A H2N2 (A/Canada/720/2005) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-Flag tag VG11688-NF
    Influenza A H2N2 (A/Canada/720/2005) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-His tag VG11688-CH
    Influenza A H2N2 (A/Canada/720/2005) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-His tag VG11688-NH

    Hemagglutinin / HA cDNA ORF Clone, H5N3, Related Products

    Product Name Catalog#(PDF)
    Influenza A H5N3 (A/duck/Hokkaido/167/07) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-Flag tag VG11696-NF
    Influenza A H5N3 (A/duck/Hokkaido/167/07) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-Myc tag VG11696-CM

    Hemagglutinin / HA cDNA ORF Clone, H8N4, Related Products

    Product Name Catalog#(PDF)
    Influenza A H8N4 (A/pintail duck/Alberta/114/1979) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-His tag VG11722-CH

    Hemagglutinin / HA cDNA ORF Clone, H4N6, Related Products

    Product Name Catalog#(PDF)
    Influenza A H4N6 (A/Swine/Ontario/01911-1/99) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-His tag VG11706-CH
    Influenza A H4N6 (A/Swine/Ontario/01911-1/99) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-Myc tag VG11706-CM
    Influenza A H4N6 (A/Swine/Ontario/01911-1/99) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized), N-Myc-tagged VG11706-NM

    Hemagglutinin / HA cDNA ORF Clone, H4N4, Related Products

    Product Name Catalog#(PDF)
    Influenza A H4N4 (mallard duck/Alberta/299/1977) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, C-HA tag VG40008-CY
    info info
    添加购物车成功! 添加购物车失败!