Encomenda rápida

Influenza A H5N1 (chicken/Yamaguchi/7/2004) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, C-HA tag

Folha de dadosAnálisesProdutos relacionadosProtocolos
H5N1 HA Informações sobre o produto de clone de cDNA
Tamanho de cDNA:1704bp
Descrição de cDNA:Full length Clone DNA of Influenza A H5N1 (chicken/Yamaguchi/7/2004) Hemagglutinin with C terminal HA tag.
Sinónimo de gene:Hemagglutinin, HA
Local de restrição:
Sequência de etiqueta:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Descrição da sequência:A number of silent mutations were introduced into the DNA sequence in order to increase its protein expression level in mammalian cell system. The translated amino acid sequence is identical with BAD89305.1.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at ambient temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Influenza A H5N1 (chicken/Yamaguchi/7/2004) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, C-HA tag on other vectors
Influenza A H5N1 (A/chicken/Yamaguchi/7/2004) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized), C-GFPSpark-taggedVG40088-ACG$345
Influenza A H5N1 (A/chicken/Yamaguchi/7/2004) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, C-OFPSpark / RFP tagVG40088-ACR$345
Influenza A H5N1 (A/chicken/Yamaguchi/7/2004) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized)VG40088-C$395
Influenza A H5N1 (chicken/Yamaguchi/7/2004) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized), C-Flag tagVG40088-CF$315
Influenza A H5N1 (chicken/Yamaguchi/7/2004) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, C-His tagVG40088-CH$315
Influenza A H5N1 (chicken/Yamaguchi/7/2004) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, C-Myc tagVG40088-CM$315
Influenza A H5N1 (chicken/Yamaguchi/7/2004) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, C-HA tagVG40088-CY$315
Influenza A H5N1 (chicken/Yamaguchi/7/2004) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, N-Flag tagVG40088-NF$315
Influenza A H5N1 (chicken/Yamaguchi/7/2004) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, N-His tagVG40088-NH$315
Influenza A H5N1 (chicken/Yamaguchi/7/2004) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized), N-Myc-taggedVG40088-NM$315
Influenza A H5N1 (chicken/Yamaguchi/7/2004) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, N-HA tagVG40088-NY$315
Influenza A H5N1 (chicken/Yamaguchi/7/2004) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized)VG40088-UT$315
 Saiba mais sobre vectores de expressão
Product nameProduct name
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.