Encomenda rápida

Gripe A H5N1 (Thailand/1(KAN-1)/2004) Neuraminidase(NA) (Codon Optimized) ORF mammalian expression plasmid, C-HA Etiqueta

    Folha de dadosAnálisesProdutos relacionadosProtocolos
    H5N1 NA Informações sobre o produto de clone de cDNA
    Gene_bank_ref_id:
    Tamanho de cDNA:1350bp
    Descrição de cDNA:Full length Clone DNA of Influenza A H5N1 (A/Thailand/1(KAN-1)/2004) Neuraminidase with C terminal HA tag.
    Sinónimo de gene:Neuraminidase, NA
    Espécie:H5N1
    Vetor:pCMV3-C-HA
    Plasmid:
    Local de restrição:
    Sequência de etiqueta:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    Descrição da sequência:A number of silent mutations were introduced into the DNA sequence in order to increase its protein expression level in mammalian cell system. The translated amino acid sequence is identical with AFF60789.1.
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Armazenamento:The lyophilized plasmid can be stored at ambient temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    Gripe A H5N1 (Thailand/1(KAN-1)/2004) Neuraminidase(NA) (Codon Optimized) ORF mammalian expression plasmid, C-HA Etiqueta on other vectors
    Gripe A H5N1 (A/Thailand/1(KAN-1)/2004) Neuraminidase(NA) ORF mammalian expression plasmid (Codon Optimized), C-GFPSpark-taggedVG40064-ACG$325
    Gripe A H5N1 (A/Thailand/1(KAN-1)/2004) Neuraminidase(NA) (Codon Optimized) ORF mammalian expression plasmid, C-OFPSpark / RFP EtiquetaVG40064-ACR$325
    Gripe A H5N1 (A/Thailand/1(KAN-1)/2004) Neuraminidase(NA) ORF mammalian expression plasmid (Codon Optimized)VG40064-C$295
    Gripe A H5N1 (Thailand/1(KAN-1)/2004) Neuraminidase(NA) ORF mammalian expression plasmid (Codon Optimized), C-Flag EtiquetaVG40064-CF$295
    Gripe A H5N1 (Thailand/1(KAN-1)/2004) Neuraminidase(NA) (Codon Optimized) ORF mammalian expression plasmid, C-His EtiquetaVG40064-CH$295
    Gripe A H5N1 (Thailand/1(KAN-1)/2004) Neuraminidase(NA) (Codon Optimized) ORF mammalian expression plasmid, C-Myc EtiquetaVG40064-CM$295
    Gripe A H5N1 (Thailand/1(KAN-1)/2004) Neuraminidase(NA) (Codon Optimized) ORF mammalian expression plasmid, C-HA EtiquetaVG40064-CY$295
    Gripe A H5N1 (Thailand/1(KAN-1)/2004) Neuraminidase(NA) (Codon Optimized) ORF mammalian expression plasmid, N-Flag EtiquetaVG40064-NF$295
    Gripe A H5N1 (Thailand/1(KAN-1)/2004) Neuraminidase(NA) (Codon Optimized) ORF mammalian expression plasmid, N-His EtiquetaVG40064-NH$295
    Gripe A H5N1 (Thailand/1(KAN-1)/2004) Neuraminidase(NA) ORF mammalian expression plasmid (Codon Optimized), N-Myc-taggedVG40064-NM$295
    Gripe A H5N1 (Thailand/1(KAN-1)/2004) Neuraminidase(NA) (Codon Optimized) ORF mammalian expression plasmid, N-HA EtiquetaVG40064-NY$295
    Gripe A H5N1 (Thailand/1(KAN-1)/2004) Neuraminidase(NA) ORF mammalian expression plasmid (Codon Optimized)VG40064-UT$295
     Saiba mais sobre vectores de expressão
    Product nameProduct name
    Fundo

    Neuraminidases are enzymes that cleave sialic acid groups from glycoproteins. Influenza neuraminidase is a type of neuraminidase found on the surface of influenza viruses that enables the virus to be released from the host cell.

    Influenza neuraminidase is composed of four identical subunits arranged in a square. It is normally attached to the virus surface through a long protein stalk. The active sites are in a deep depression on the upper surface. They bind to polysaccharide chains and clip off the sugars at the end. The surface of neuraminidase is decorated with several polysaccharide chains that are similar to the polysaccharide chains that decorate our own cell surface proteins.

    Neuraminidase (NA) and hemagglutinin (HA) are major membrane glycoproteins found on the surface of influenza virus. Hemagglutinin binds to the sialic acid-containing receptors on the surface of host cells during initial infection and at the end of an infectious cycle. Neuraminidase, on the other hand, cleaves the HA-sialic acid bondage from the newly formed virions and the host cell receptors during budding. Neuraminidase thus is described as a receptor-destroying enzyme which facilitates virus release and efficient spread of the progeny virus from cell to cell.

    Influenza antibody and influenza antibodies are very important research tools for influenza diagnosis, influenza vaccine development, and anti-influenza virus therapy development. Monoclonal or polyclonal antibody can be raised with protein based antigen or peptide based antigen. Antibody raised with protein based antigen could have better specificity and/or binding affinity than antibody raised with peptide based antigen, but cost associated with the recombinant protein antigen is usually higher. Anti influenza virus hemagglutinin (HA) monoclonal antibody or polyclonal antibody can be used for ELISA assay, western blotting detection, Immunohistochemistry (IHC), flow cytometry, neutralization assay, hemagglutinin inhibition assay, and early diagnosis of influenza viral infection.

    Sino Biological has developed state-of-the-art monoclonal antibody development technology platforms: mouse monoclonal antibody and rabbit monoclonal antibody. Our rabbit monoclonal antibody platform is one of a kind and offers some unique advantages over mouse monoclonal antibodies, such as high affinity, low cross-reactivity with rabbit polyclonal antibodies.

    Referências
  • Sardet C., et al.,(1989), Molecular cloning, primary structure, and expression of the human growth factor-activatable Na+/H+ antiporter. Cell 56:271-280.
  • Sardet C., et al., (1990), Growth factors induce phosphorylation of the Na+/H+ antiporter, glycoprotein of 110 kD.Science 247:723-726.
  • Tse C.-M., et al.,(1991), Molecular cloning and expression of a cDNA encoding the rabbit ileal villus cell basolateral membrane Na+/H+ exchanger.EMBO J. 10:1957-1967.
  • Size / Price
    Catálogo: VG40064-CY
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade
    Acrescentar a carrinhoBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
      Itens recentemente visualizados
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"