Encomenda rápida

Gripe A H5N1 (Hubei/1/2010) Hemaglutinina(HA) (Codon Optimized) ORF mammalian expression plasmid, C-HA Etiqueta

    Folha de dadosAnálisesProdutos relacionadosProtocolos
    H5N1 HA Informações sobre o produto de clone de cDNA
    Gene_bank_ref_id:
    Tamanho de cDNA:1704bp
    Descrição de cDNA:Full length Clone DNA of Influenza A H5N1 (A/Hubei/1/2010) Hemagglutinin with C terminal HA tag.
    Sinónimo de gene:Hemagglutinin, HA
    Espécie:H5N1
    Vetor:pCMV3-C-HA
    Plasmid:
    Local de restrição:
    Sequência de etiqueta:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    Descrição da sequência:A number of silent mutations were introduced into the DNA sequence in order to increase its protein expression level in mammalian cell system. The translated amino acid sequence is identical with AEO89181.1.
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Armazenamento:The lyophilized plasmid can be stored at ambient temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    Gripe A H5N1 (Hubei/1/2010) Hemaglutinina(HA) (Codon Optimized) ORF mammalian expression plasmid, C-HA Etiqueta on other vectors
    Gripe A H5N1 (A/Hubei/1/2010) Hemaglutinina(HA) ORF mammalian expression plasmid (Codon Optimized), C-GFPSpark-taggedVG40060-ACG$345
    Gripe A H5N1 (A/Hubei/1/2010) Hemaglutinina(HA) (Codon Optimized) ORF mammalian expression plasmid, C-OFPSpark / RFP EtiquetaVG40060-ACR$345
    Gripe A H5N1 (Hubei/1/2010) Hemaglutinina(HA) ORF mammalian expression plasmid (Codon Optimized), C-Flag EtiquetaVG40060-CF$315
    Gripe A H5N1 (Hubei/1/2010) Hemaglutinina(HA) (Codon Optimized) ORF mammalian expression plasmid, C-His EtiquetaVG40060-CH$315
    Gripe A H5N1 (Hubei/1/2010) Hemaglutinina(HA) (Codon Optimized) ORF mammalian expression plasmid, C-Myc EtiquetaVG40060-CM$315
    Gripe A H5N1 (Hubei/1/2010) Hemaglutinina(HA) (Codon Optimized) ORF mammalian expression plasmid, C-HA EtiquetaVG40060-CY$315
    Gripe A H5N1 (A/Hubei/1/2010) Hemaglutinina(HA) ORF mammalian expression plasmid (Codon Optimized)VG40060-G$115
    Gripe A H5N1 (Hubei/1/2010) Hemaglutinina(HA) (Codon Optimized) ORF mammalian expression plasmid, N-Flag EtiquetaVG40060-NF$315
    Gripe A H5N1 (Hubei/1/2010) Hemaglutinina(HA) (Codon Optimized) ORF mammalian expression plasmid, N-His EtiquetaVG40060-NH$315
    Gripe A H5N1 (Hubei/1/2010) Hemaglutinina(HA) ORF mammalian expression plasmid (Codon Optimized), N-Myc-taggedVG40060-NM$315
    Gripe A H5N1 (Hubei/1/2010) Hemaglutinina(HA) (Codon Optimized) ORF mammalian expression plasmid, N-HA EtiquetaVG40060-NY$315
    Gripe A H5N1 (Hubei/1/2010) Hemaglutinina(HA) ORF mammalian expression plasmid (Codon Optimized)VG40060-UT$315
     Saiba mais sobre vectores de expressão
    Product nameProduct name
    Fundo

    The influenza viral Hemagglutinin (HA) protein is a homo trimer with a receptor binding pocket on the globular head of each monomer.HA has at least 18 different antigens. These subtypes are named H1 through H18.HA has two functions. Firstly, it allows the recognition of target vertebrate cells, accomplished through the binding to these cells' sialic acid-containing receptors. Secondly, once bound it facilitates the entry of the viral genome into the target cells by causing the fusion of host endosomal membrane with the viral membrane.The influenza virus Hemagglutinin (HA) protein is translated in cells as a single protein, HA0, or hemagglutinin precursor protein. For viral activation, hemagglutinin precursor protein (HA0) must be cleaved by a trypsin-like serine endoprotease at a specific site, normally coded for by a single basic amino acid (usually arginine) between the HA1 and HA2 domains of the protein. After cleavage, the two disulfide-bonded protein domains produce the mature form of the protein subunits as a prerequisite for the conformational change necessary for fusion and hence viral infectivity.

    Referências
  • White JM, Hoffman LR, Arevalo JH, et al. (1997). "Attachment and entry of influenza virus into host cells. Pivotal roles of hemagglutinin". In Chiu W, Burnett RM, Garcea RL. Structural Biology of Viruses.
  • Suzuki Y (March 2005). "Sialobiology of influenza: molecular mechanism of host range variation of influenza viruses". Biol. Pharm. Bull. 28 (3): 399–408.
  • Senne DA, Panigrahy B, Kawaoka Y, et al. (1996). "Survey of the hemagglutinin (HA) cleavage site sequence of H5 and H7 avian influenza viruses: amino acid sequence at the HA cleavage site as a marker of pathogenicity potential". Avian Dis. 40 (2): 425–37
  • Size / Price
    Catálogo: VG40060-CY
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade
    Acrescentar a carrinhoBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
      Itens recentemente visualizados
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"