Encomenda rápida

Text Size:AAA

Influenza A H5N1 (A/Duck/Hong Kong/p46/97) Hemagglutinin ORF mammalian expression plasmid, N-His tag, expression ready

Folha de dadosAnálisesProdutos relacionadosProtocolos
H5N1 HA Informações sobre o produto de clone de cDNA
Tamanho de cDNA:1725bp
Descrição de cDNA:Full length Clone DNA of Influenza A H5N1 (A/Duck/Hong Kong/p46/97) HA with N terminal His tag.
Sinónimo de gene:HA1, Hemagglutinin
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:A number of silent mutations were introduced into the DNA sequence in order to increase its protein expression level in mammalian cell system. The translated amino acid sequence is identical with AAF02306.1.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at ambient temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Influenza A H5N1 (A/Duck/Hong Kong/p46/97) Hemagglutinin ORF mammalian expression plasmid, N-His tag, expression ready on other vectors
Influenza A H5N1 (A/Duck/Hong Kong/p46/97) Hemagglutinin ORF mammalian expression plasmid, C-GFPSpark tag, expression readyVG40001-ACG$345
Influenza A H5N1 (A/Duck/Hong Kong/p46/97) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-OFPSpark / RFP tagVG40001-ACR$345
Influenza A H5N1 (A/Duck/Hong Kong/p46/97) Hemagglutinin natural ORF mammalian expression plasmidVG40001-C$315
Influenza A H5N1 (A/Duck/Hong Kong/p46/97) Hemagglutinin ORF mammalian expression plasmid, C-Flag tag, expression readyVG40001-CF$315
Influenza A H5N1 (A/Duck/Hong Kong/p46/97) Hemagglutinin ORF mammalian expression plasmid, C-His tag, expression readyVG40001-CH$315
Influenza A H5N1 (A/Duck/Hong Kong/p46/97) Hemagglutinin ORF mammalian expression plasmid, C-Myc tag, expression readyVG40001-CM$315
Influenza A H5N1 (A/Duck/Hong Kong/p46/97) Hemagglutinin ORF mammalian expression plasmid, C-HA tag, expression readyVG40001-CY$315
Influenza A H5N1 (A/Duck/Hong Kong/p46/97) Hemagglutinin ORF mammalian expression plasmid, N-Flag tagVG40001-NF$315
Influenza A H5N1 (A/Duck/Hong Kong/p46/97) Hemagglutinin ORF mammalian expression plasmid, N-His tag, expression readyVG40001-NH$315
Influenza A H5N1 (A/Duck/Hong Kong/p46/97) Hemagglutinin ORF mammalian expression plasmid, N-Myc tag, expression readyVG40001-NM$315
Influenza A H5N1 (A/Duck/Hong Kong/p46/97) Hemagglutinin ORF mammalian expression plasmid, N-HA tag, expression readyVG40001-NY$315
Influenza A H5N1 (A/Duck/Hong Kong/p46/97) Hemagglutinin natural ORF mammalian expression plasmid, expression readyVG40001-UT$315
 Saiba mais sobre vectores de expressão
Product nameProduct name
Size / Price
Catálogo: VG40001-NH
Preço de catálogo:   (Save )
Preço:      [How to order]
Disponibilidade2-3 weeksInstruções de envio
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.