After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Gripe A H4N8 (chicken/Alabama/1/1975) Hemaglutinina(HA) (Codon Optimized) ORF mammalian expression plasmid, N-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
H4N8 HA Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:
Tamanho de cDNA:1695bp
Descrição de cDNA:Full length Clone DNA of Influenza A H4N8 (A/chicken/Alabama/1/1975) Hemagglutinin with N terminal His tag.
Sinónimo de gene:Hemagglutinin, HA
Espécie:H4N8
Vetor:pCMV3-SP-N-His
Plasmid:
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:A number of silent mutations were introduced into the DNA sequence in order to increase its protein expression level in mammalian cell system. The translated amino acid sequence is identical with P19695.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at ambient temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Gripe A H4N8 (chicken/Alabama/1/1975) Hemaglutinina(HA) (Codon Optimized) ORF mammalian expression plasmid, N-His Etiqueta on other vectors
Gripe A H4N8 (A/chicken/Alabama/1/1975) Hemaglutinina(HA) ORF mammalian expression plasmid (Codon Optimized), C-GFPSpark-taggedVG40025-ACG$345
Gripe A H4N8 (A/chicken/Alabama/1/1975) Hemaglutinina(HA) (Codon Optimized) ORF mammalian expression plasmid, C-OFPSpark / RFP EtiquetaVG40025-ACR$345
Gripe A H4N8 (A/chicken/Alabama/1/1975) Hemaglutinina(HA) ORF mammalian expression plasmid (Codon Optimized)VG40025-C$315
Gripe A H4N8 (chicken/Alabama/1/1975) Hemaglutinina(HA) ORF mammalian expression plasmid (Codon Optimized), C-Flag EtiquetaVG40025-CF$315
Gripe A H4N8 (chicken/Alabama/1/1975) Hemaglutinina(HA) (Codon Optimized) ORF mammalian expression plasmid, C-His EtiquetaVG40025-CH$315
Gripe A H4N8 (chicken/Alabama/1/1975) Hemaglutinina(HA) (Codon Optimized) ORF mammalian expression plasmid, C-Myc EtiquetaVG40025-CM$315
Gripe A H4N8 (chicken/Alabama/1/1975) Hemaglutinina(HA) (Codon Optimized) ORF mammalian expression plasmid, C-HA EtiquetaVG40025-CY$315
Gripe A H4N8 (chicken/Alabama/1/1975) Hemaglutinina(HA) (Codon Optimized) ORF mammalian expression plasmid, N-Flag EtiquetaVG40025-NF$315
Gripe A H4N8 (chicken/Alabama/1/1975) Hemaglutinina(HA) (Codon Optimized) ORF mammalian expression plasmid, N-His EtiquetaVG40025-NH$315
Gripe A H4N8 (chicken/Alabama/1/1975) Hemaglutinina(HA) ORF mammalian expression plasmid (Codon Optimized), N-Myc-taggedVG40025-NM$315
Gripe A H4N8 (chicken/Alabama/1/1975) Hemaglutinina(HA) (Codon Optimized) ORF mammalian expression plasmid, N-HA EtiquetaVG40025-NY$315
Gripe A H4N8 (chicken/Alabama/1/1975) Hemaglutinina(HA) ORF mammalian expression plasmid (Codon Optimized)VG40025-UT$315
 Saiba mais sobre vectores de expressão
Product nameProduct name
Fundo

The influenza viral Hemagglutinin (HA) protein is a homo trimer with a receptor binding pocket on the globular head of each monomer.HA has at least 18 different antigens. These subtypes are named H1 through H18.HA has two functions. Firstly, it allows the recognition of target vertebrate cells, accomplished through the binding to these cells' sialic acid-containing receptors. Secondly, once bound it facilitates the entry of the viral genome into the target cells by causing the fusion of host endosomal membrane with the viral membrane.The influenza virus Hemagglutinin (HA) protein is translated in cells as a single protein, HA0, or hemagglutinin precursor protein. For viral activation, hemagglutinin precursor protein (HA0) must be cleaved by a trypsin-like serine endoprotease at a specific site, normally coded for by a single basic amino acid (usually arginine) between the HA1 and HA2 domains of the protein. After cleavage, the two disulfide-bonded protein domains produce the mature form of the protein subunits as a prerequisite for the conformational change necessary for fusion and hence viral infectivity.

Referências
  • White JM, Hoffman LR, Arevalo JH, et al. (1997). "Attachment and entry of influenza virus into host cells. Pivotal roles of hemagglutinin". In Chiu W, Burnett RM, Garcea RL. Structural Biology of Viruses.
  • Suzuki Y (March 2005). "Sialobiology of influenza: molecular mechanism of host range variation of influenza viruses". Biol. Pharm. Bull. 28 (3): 399–408.
  • Senne DA, Panigrahy B, Kawaoka Y, et al. (1996). "Survey of the hemagglutinin (HA) cleavage site sequence of H5 and H7 avian influenza viruses: amino acid sequence at the HA cleavage site as a marker of pathogenicity potential". Avian Dis. 40 (2): 425–37
  • Size / Price
    Catálogo: VG40025-NH
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
    Imagens
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"