After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Encomenda rápida

Text Size:AAA

Gripe A H12N5 (green-winged teal/ALB/199/1991) Neuraminidase(NA) ORF mammalian expression plasmid, C-HA Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
H12N5 NA Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:CY005352.1
Tamanho de cDNA:1422bp
Descrição de cDNA:Full length Clone DNA of Influenza A H12N5 (A/green-winged teal/ALB/199/1991) Neuraminidase with C terminal HA tag.
Sinónimo de gene:Neuraminidase, NA
Espécie:H12N5
Vetor:pCMV3-C-HA
Plasmid:
Local de restrição:
Sequência de etiqueta:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Descrição da sequência:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at ambient temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Gripe A H12N5 (green-winged teal/ALB/199/1991) Neuraminidase(NA) ORF mammalian expression plasmid, C-HA Etiqueta on other vectors
Gripe A H12N5 (A/green-winged teal/ALB/199/1991) Neuraminidase(NA) ORF mammalian expression plasmid, C-GFPSpark EtiquetaVG40237-ACG$325
Gripe A H12N5 (A/green-winged teal/ALB/199/1991) Neuraminidase(NA) ORF mammalian expression plasmid, C-OFPSpark / RFP EtiquetaVG40237-ACR$325
Gripe A H12N5 (green-winged teal/ALB/199/1991) Neuraminidase(NA) ORF mammalian expression plasmid, C-Flag EtiquetaVG40237-CF$295
Gripe A H12N5 (green-winged teal/ALB/199/1991) Neuraminidase(NA) ORF mammalian expression plasmid, C-His EtiquetaVG40237-CH$295
Gripe A H12N5 (green-winged teal/ALB/199/1991) Neuraminidase(NA) ORF mammalian expression plasmid, C-Myc EtiquetaVG40237-CM$295
Gripe A H12N5 (green-winged teal/ALB/199/1991) Neuraminidase(NA) ORF mammalian expression plasmid, C-HA EtiquetaVG40237-CY$295
Gripe A H12N5 (A/green-winged teal/ALB/199/1991) Neuraminidase(NA) ORF mammalian expression plasmid (Codon Optimized)VG40237-G$95
Gripe A H12N5 (green-winged teal/ALB/199/1991) Neuraminidase(NA) ORF mammalian expression plasmid, N-Flag EtiquetaVG40237-NF$295
Gripe A H12N5 (green-winged teal/ALB/199/1991) Neuraminidase(NA) ORF mammalian expression plasmid, N-His EtiquetaVG40237-NH$295
Gripe A H12N5 (green-winged teal/ALB/199/1991) Neuraminidase(NA) ORF mammalian expression plasmid, N-Myc EtiquetaVG40237-NM$295
Gripe A H12N5 (green-winged teal/ALB/199/1991) Neuraminidase(NA) ORF mammalian expression plasmid, N-HA EtiquetaVG40237-NY$295
Gripe A H12N5 (green-winged teal/ALB/199/1991) Neuraminidase(NA) natural ORF mammalian expression plasmidVG40237-UT$295
 Saiba mais sobre vectores de expressão
Product nameProduct name
Fundo

Neuraminidases are enzymes that cleave sialic acid groups from glycoproteins. Influenza neuraminidase is a type of neuraminidase found on the surface of influenza viruses that enables the virus to be released from the host cell.

Influenza neuraminidase is composed of four identical subunits arranged in a square. It is normally attached to the virus surface through a long protein stalk. The active sites are in a deep depression on the upper surface. They bind to polysaccharide chains and clip off the sugars at the end. The surface of neuraminidase is decorated with several polysaccharide chains that are similar to the polysaccharide chains that decorate our own cell surface proteins.

Neuraminidase (NA) and hemagglutinin (HA) are major membrane glycoproteins found on the surface of influenza virus. Hemagglutinin binds to the sialic acid-containing receptors on the surface of host cells during initial infection and at the end of an infectious cycle. Neuraminidase, on the other hand, cleaves the HA-sialic acid bondage from the newly formed virions and the host cell receptors during budding. Neuraminidase thus is described as a receptor-destroying enzyme which facilitates virus release and efficient spread of the progeny virus from cell to cell.

Influenza antibody and influenza antibodies are very important research tools for influenza diagnosis, influenza vaccine development, and anti-influenza virus therapy development. Monoclonal or polyclonal antibody can be raised with protein based antigen or peptide based antigen. Antibody raised with protein based antigen could have better specificity and/or binding affinity than antibody raised with peptide based antigen, but cost associated with the recombinant protein antigen is usually higher. Anti influenza virus hemagglutinin (HA) monoclonal antibody or polyclonal antibody can be used for ELISA assay, western blotting detection, Immunohistochemistry (IHC), flow cytometry, neutralization assay, hemagglutinin inhibition assay, and early diagnosis of influenza viral infection.

Sino Biological has developed state-of-the-art monoclonal antibody development technology platforms: mouse monoclonal antibody and rabbit monoclonal antibody. Our rabbit monoclonal antibody platform is one of a kind and offers some unique advantages over mouse monoclonal antibodies, such as high affinity, low cross-reactivity with rabbit polyclonal antibodies.

Size / Price
Catálogo: VG40237-CY
Preço de catálogo: 
Preço:      (You Save: )
Tamanho:
Quantidade:+-
Disponibilidade2-3 weeks
Bulk Discount RequiryAcrescentar a carrinho
Contact Us
Imagens
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"