Encomenda rápida

Gripe A H12N5 (A/green-winged teal/ALB/199/1991 ) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
H12N5 HA Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:
Tamanho de cDNA:1695bp
Descrição de cDNA:Full length Clone DNA of Influenza A H12N5 (A/green-winged teal/ALB/199/1991) HA with N terminal His tag.
Sinónimo de gene:HA1, Hemagglutinin
Espécie:H12N5
Vetor:pCMV3-SP-N-His
Plasmid:
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:A number of silent mutations were introduced into the DNA sequence in order to increase its protein expression level in mammalian cell system. The translated amino acid sequence is identical with ABB88110.1.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at ambient temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Gripe A H12N5 (A/green-winged teal/ALB/199/1991 ) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-His Etiqueta on other vectors
Gripe A H12N5 (A/green-winged teal/ALB/199/1991 ) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized), C-GFPSpark-taggedVG11718-ACG$345
Gripe A H12N5 (A/green-winged teal/ALB/199/1991 ) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-OFPSpark / RFP EtiquetaVG11718-ACR$345
Gripe A H12N5 (A/green-winged teal/ALB/199/1991 ) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized)VG11718-C$315
Gripe A H12N5 (A/green-winged teal/ALB/199/1991 ) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized), C-Flag EtiquetaVG11718-CF$315
Gripe A H12N5 (A/green-winged teal/ALB/199/1991 ) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-His EtiquetaVG11718-CH$315
Gripe A H12N5 (A/green-winged teal/ALB/199/1991 ) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-Myc EtiquetaVG11718-CM$315
Gripe A H12N5 (A/green-winged teal/ALB/199/1991 ) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-HA EtiquetaVG11718-CY$315
Gripe A H12N5 (A/green-winged teal/ALB/199/1991 ) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-Flag EtiquetaVG11718-NF$315
Gripe A H12N5 (A/green-winged teal/ALB/199/1991 ) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-His EtiquetaVG11718-NH$315
Gripe A H12N5 (A/green-winged teal/ALB/199/1991 ) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized), N-Myc-taggedVG11718-NM$315
Gripe A H12N5 (A/green-winged teal/ALB/199/1991 ) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-HA EtiquetaVG11718-NY$315
Gripe A H12N5 (A/green-winged teal/ALB/199/1991 ) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized)VG11718-UT$315
 Saiba mais sobre vectores de expressão
Product nameProduct name
Size / Price
Catálogo: VG11718-NH
Preço de catálogo: 
Preço:      (You Save: )
Tamanho:
Quantidade:+-
Disponibilidade2-3 weeks
Bulk Discount RequiryAcrescentar a carrinho
Contact Us
Imagens
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"