Encomenda rápida

Gripe A H10N8 (A/duck/Guangdong/E1/2012) Neuraminidase(NA) ORF mammalian expression plasmid, N-His Etiqueta

    Folha de dadosAnálisesProdutos relacionadosProtocolos
    H10N8 NA Informações sobre o produto de clone de cDNA
    Gene_bank_ref_id:JQ924787.1
    Tamanho de cDNA:1401bp
    Descrição de cDNA:Full length Clone DNA of Influenza A H10N8 (A/duck/Guangdong/E1/2012) NA with N terminal His tag.
    Sinónimo de gene:NA
    Espécie:H10N8
    Vetor:pCMV3-SP-N-His
    Plasmid:
    Local de restrição:
    Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Descrição da sequência:Identical with the Gene Bank Ref. ID sequence.
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Armazenamento:The lyophilized plasmid can be stored at ambient temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    Gripe A H10N8 (A/duck/Guangdong/E1/2012) Neuraminidase(NA) ORF mammalian expression plasmid, N-His Etiqueta on other vectors
    Gripe A H10N8 (A/duck/Guangdong/E1/2012) Neuraminidase(NA) ORF mammalian expression plasmid, C-GFPSpark EtiquetaVG40203-ACG$325
    Gripe A H10N8 (A/duck/Guangdong/E1/2012) Neuraminidase(NA) ORF mammalian expression plasmid, C-OFPSpark / RFP EtiquetaVG40203-ACR$325
    Gripe A H10N8 (A/duck/Guangdong/E1/2012) Neuraminidase(NA) ORF mammalian expression plasmid, N-GFPSpark EtiquetaVG40203-ANG$325
    Gripe A H10N8 (A/duck/Guangdong/E1/2012) Neuraminidase(NA) ORF mammalian expression plasmid, N-OFPSpark / RFP EtiquetaVG40203-ANR$325
    Gripe A H10N8 (A/duck/Guangdong/E1/2012) Neuraminidase(NA) ORF mammalian expression plasmid, C-Flag EtiquetaVG40203-CF$295
    Gripe A H10N8 (A/duck/Guangdong/E1/2012) Neuraminidase(NA) ORF mammalian expression plasmid, C-His EtiquetaVG40203-CH$295
    Gripe A H10N8 (A/duck/Guangdong/E1/2012) Neuraminidase(NA) ORF mammalian expression plasmid, C-Myc EtiquetaVG40203-CM$295
    Gripe A H10N8 (A/duck/Guangdong/E1/2012) Neuraminidase(NA) ORF mammalian expression plasmid, C-HA EtiquetaVG40203-CY$295
    Gripe A H10N8 (A/duck/Guangdong/E1/2012) Neuraminidase(NA) natural ORF mammalian expression plasmidVG40203-G$95
    Gripe A H10N8 (A/duck/Guangdong/E1/2012) Neuraminidase(NA) ORF mammalian expression plasmid, N-Flag EtiquetaVG40203-NF$295
    Gripe A H10N8 (A/duck/Guangdong/E1/2012) Neuraminidase(NA) ORF mammalian expression plasmid, N-His EtiquetaVG40203-NH$295
    Gripe A H10N8 (A/duck/Guangdong/E1/2012) Neuraminidase(NA) ORF mammalian expression plasmid, N-Myc EtiquetaVG40203-NM$295
    Gripe A H10N8 (A/duck/Guangdong/E1/2012) Neuraminidase(NA) ORF mammalian expression plasmid, N-HA EtiquetaVG40203-NY$295
    Gripe A H10N8 (A/duck/Guangdong/E1/2012) Neuraminidase(NA) natural ORF mammalian expression plasmidVG40203-UT$295
     Saiba mais sobre vectores de expressão
    Product nameProduct name
    Fundo

    Neuraminidases are enzymes that cleave sialic acid groups from glycoproteins. Influenza neuraminidase is a type of neuraminidase found on the surface of influenza viruses that enables the virus to be released from the host cell.

    Influenza neuraminidase is composed of four identical subunits arranged in a square. It is normally attached to the virus surface through a long protein stalk. The active sites are in a deep depression on the upper surface. They bind to polysaccharide chains and clip off the sugars at the end. The surface of neuraminidase is decorated with several polysaccharide chains that are similar to the polysaccharide chains that decorate our own cell surface proteins.

    Neuraminidase (NA) and hemagglutinin (HA) are major membrane glycoproteins found on the surface of influenza virus. Hemagglutinin binds to the sialic acid-containing receptors on the surface of host cells during initial infection and at the end of an infectious cycle. Neuraminidase, on the other hand, cleaves the HA-sialic acid bondage from the newly formed virions and the host cell receptors during budding. Neuraminidase thus is described as a receptor-destroying enzyme which facilitates virus release and efficient spread of the progeny virus from cell to cell.

    Influenza antibody and influenza antibodies are very important research tools for influenza diagnosis, influenza vaccine development, and anti-influenza virus therapy development. Monoclonal or polyclonal antibody can be raised with protein based antigen or peptide based antigen. Antibody raised with protein based antigen could have better specificity and/or binding affinity than antibody raised with peptide based antigen, but cost associated with the recombinant protein antigen is usually higher. Anti influenza virus hemagglutinin (HA) monoclonal antibody or polyclonal antibody can be used for ELISA assay, western blotting detection, Immunohistochemistry (IHC), flow cytometry, neutralization assay, hemagglutinin inhibition assay, and early diagnosis of influenza viral infection.

    Sino Biological has developed state-of-the-art monoclonal antibody development technology platforms: mouse monoclonal antibody and rabbit monoclonal antibody. Our rabbit monoclonal antibody platform is one of a kind and offers some unique advantages over mouse monoclonal antibodies, such as high affinity, low cross-reactivity with rabbit polyclonal antibodies.

    Referências
  • Sardet C., et al.,(1989), Molecular cloning, primary structure, and expression of the human growth factor-activatable Na+/H+ antiporter. Cell 56:271-280.
  • Sardet C., et al., (1990), Growth factors induce phosphorylation of the Na+/H+ antiporter, glycoprotein of 110 kD.Science 247:723-726.
  • Tse C.-M., et al.,(1991), Molecular cloning and expression of a cDNA encoding the rabbit ileal villus cell basolateral membrane Na+/H+ exchanger.EMBO J. 10:1957-1967.
  • Size / Price
    Catálogo: VG40203-NH
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade
    Acrescentar a carrinhoBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"