Encomenda rápida

Text Size:AAA

Humano tPA transcript variant 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human PLAT Informações sobre o produto de clone de cDNA
Tamanho de cDNA:1689bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens plasminogen activator, tissue (PLAT), transcript variant 1 with N terminal Myc tag.
Sinónimo de gene:PLAT, TPA, T-PA, DKFZp686I03148
Local de restrição:
Sequência de etiqueta:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Humano tPA transcript variant 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc Etiqueta on other vectors
Humano tPA transcript variant 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG10157-ACG$245
Humano tPA transcript variant 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG10157-ACR$245
Humano tPA transcript variant 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG10157-CF$215
Humano tPA transcript variant 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG10157-CH$215
Humano tPA transcript variant 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG10157-CM$215
Humano tPA transcript variant 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG10157-CY$215
Humano tPA transcript variant 1 clonagem de ADN ou de clonagem do gene (vector de expressão)HG10157-M$75
Humano tPA transcript variant 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG10157-M-F$215
Humano tPA transcript variant 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG10157-NF$215
Humano tPA transcript variant 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG10157-NH$215
Humano tPA transcript variant 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG10157-NM$215
Humano tPA transcript variant 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG10157-NY$215
Humano tPA transcript variant 1 clonagem de ADN ou de clonagem do gene (vector de clonagem)HG10157-UT$215
 Saiba mais sobre vectores de expressão
Product nameProduct name

Tissue plasminogen activator (abbreviated tPA or PLAT), is traditionally viewed as a simple serine protease whose main function is to convert plasminogen into biologically active plasmin. As a protease, tPA plays a crucial role in regulating blood fibrinolysis, in maintaining the homeostasis of extracellular matrix and in modulating the post-translational activation of growth factors. tPA is synthesized and secreted as a single chain polypeptide precursor which is cleaved in turn by plasmin. Proteolytic cleavage at the C-terminal side of Arg275 generates the enzyme composed of two subunits, designated as α and β chains which are held together by a single disulfide bond. Unlike the other members of the chymotrypsin family, tPA has one particular distinction in that the catalytic efficiency of the single-chain enzyme is only slightly lower than that of the proteolytically cleaved form and is therefore not a true zymogen. tPA is found not only in the blood, where its primary function is as a thrombolytic enzyme, but also in the central nervous system (CNS). It participats in a number of physiological and pathological events in the CNS, as well as the role of neuroserpin as the natural regulator of tPA's activity in these processes. Increased or decreased activity of tPA leads to hyperfibrinolysis or hypofibrinolysis, respectively. In addition, as a cytokine, tPA plays a pivotal role in the pathogenesis of renal interstitial fibrosis through diverse mechanisms. Thus, as a fibrogenic cytokine, it promotes the progression of kidney diseases.

  • Yepes M, et al. (2004) New functions for an old enzyme: nonhemostatic roles for tissue-type plasminogen activator in the central nervous system. Exp Biol Med (Maywood). 229(11): 1097-104.
  • Samson AL, et al. (2006) Tissue-type plasminogen activator: a multifaceted modulator of neurotransmission and synaptic plasticity. Neuron. 50(5): 673-8.
  • Skrzypiec AE, et al. (2008) Tissue plasminogen activator in the amygdala: a new role for an old protease. J Physiol Pharmacol. 59 Suppl 8: 135-46.
  • Hu K, et al. (2008) Novel actions of tissue-type plasminogen activator in chronic kidney disease. Front Biosci. 13: 5174-86.
  • Size / Price
    Catálogo: HG10157-NM
    Preço de catálogo: 
    Preço:      (You Save: )
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.