After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Humano respiratory syncytial virus (RSV) (subtype A, strain RSS-2) Fusion glycoprotein / RSV-F (Codon Optimized) ORF mammalian expression plasmid, C-HA Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
RSV RSV-F Informações sobre o produto de clone de cDNA
Tamanho de cDNA:1725bp
Descrição de cDNA:Full length Clone DNA of Human RSV (subtype A, strain RSS-2) Fusion glycoprotein / RSV-F with C terminal HA tag.
Sinónimo de gene:F, HRSVgp08
Local de restrição:
Sequência de etiqueta:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Descrição da sequência:A number of silent mutations were introduced into the DNA sequence in order to increase its protein expression level in mammalian cell system. The translated amino acid sequence is identical with P11209.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at ambient temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Humano respiratory syncytial virus (RSV) (subtype A, strain RSS-2) Fusion glycoprotein / RSV-F (Codon Optimized) ORF mammalian expression plasmid, C-HA Etiqueta on other vectors
Humano respiratory syncytial virus (RSV) (subtype A, strain RSS-2) Fusion glycoprotein / RSV-F ORF mammalian expression plasmid (Codon Optimized), C-GFPSpark-taggedVG40037-ACG$345
Humano respiratory syncytial virus (RSV) (subtype A, strain RSS-2) Fusion glycoprotein / RSV-F (Codon Optimized) ORF mammalian expression plasmid, C-OFPSpark / RFP EtiquetaVG40037-ACR$345
Humano respiratory syncytial virus (RSV) (subtype A, strain RSS-2) Fusion glycoprotein / RSV-F ORF mammalian expression plasmid (Codon Optimized), C-Flag EtiquetaVG40037-CF$315
Humano respiratory syncytial virus (RSV) (subtype A, strain RSS-2) Fusion glycoprotein / RSV-F (Codon Optimized) ORF mammalian expression plasmid, C-His EtiquetaVG40037-CH$315
Humano respiratory syncytial virus (RSV) (subtype A, strain RSS-2) Fusion glycoprotein / RSV-F (Codon Optimized) ORF mammalian expression plasmid, C-Myc EtiquetaVG40037-CM$315
Humano respiratory syncytial virus (RSV) (subtype A, strain RSS-2) Fusion glycoprotein / RSV-F (Codon Optimized) ORF mammalian expression plasmid, C-HA EtiquetaVG40037-CY$315
Humano respiratory syncytial virus (RSV) (subtype A, strain RSS-2) Fusion glycoprotein / RSV-F ORF mammalian expression plasmid (Codon Optimized)VG40037-G$115
Humano respiratory syncytial virus (RSV) (subtype A, strain RSS-2) Fusion glycoprotein / RSV-F (Codon Optimized) ORF mammalian expression plasmid, N-Flag EtiquetaVG40037-NF$315
Humano respiratory syncytial virus (RSV) (subtype A, strain RSS-2) Fusion glycoprotein / RSV-F (Codon Optimized) ORF mammalian expression plasmid, N-His EtiquetaVG40037-NH$315
Humano respiratory syncytial virus (RSV) (subtype A, strain RSS-2) Fusion glycoprotein / RSV-F ORF mammalian expression plasmid (Codon Optimized), N-Myc-taggedVG40037-NM$315
Humano respiratory syncytial virus (RSV) (subtype A, strain RSS-2) Fusion glycoprotein / RSV-F (Codon Optimized) ORF mammalian expression plasmid, N-HA EtiquetaVG40037-NY$315
Humano respiratory syncytial virus (RSV) (subtype A, strain RSS-2) Fusion glycoprotein / RSV-F ORF mammalian expression plasmid (Codon Optimized)VG40037-UT$315
 Saiba mais sobre vectores de expressão
Product nameProduct name

Human respiratory syncytial virus (HRSV) is the most common etiological agent of acute lower respiratory tract disease in infants and can cause repeated infections throughout life. It is classified within the genus pneumovirus of the family paramyxoviridae. Like other members of the family, HRSV has two major surface glycoproteins (G and F) that play important roles in the initial stages of the infectious cycle. The G protein mediates attachment of the virus to cell surface receptors, while the F protein promotes fusion of the viral and cellular membranes, allowing entry of the virus ribonucleoprotein into the cell cytoplasm. The fusion (F) protein of RSV is synthesized as a nonfusogenic precursor protein (F0), which during its migration to the cell surface is activated by cleavage into the disulfide-linked F1 and F2 subunits. This fusion is pH independent and occurs directly at the outer cell membrane, and the F2 subunit was identifed as the major determinant of RSV host cell specificity. The trimer of F1-F2 interacts with glycoprotein G at the virion surface. Upon binding of G to heparan sulfate, the hydrophobic fusion peptide is unmasked and induces the fusion between host cell and virion membranes. Notably, RSV fusion protein is unique in that it is able to interact directly with heparan sulfate and therefore is sufficient for virus infection. Furthermore, the fusion protein is also able to trigger p53-dependent apoptosis.

  • Martin-Gallardo A. et al., 1993, J Gen Virol. 74 (3): 453-8.
  • Jose A M. et al., 1997, J Gen Virol. 78: 2411-8.
  • Feldman SA. et al., 1999, J Virol. 73 (8): 6610-7.
  • Zlateva K.T. et al., 2004, J Virol. 78 (9): 4675-83.
  • Trento A. et al., 2006, J Virol. 80 (2): 975-84.
  • Branigan P J. et al., 2006, J Gen Virol. 87 (2): 395-8.
  • Eckardt-Michel J. et al., 2008, J. Virol. 82: 3236-49.
  • Size / Price
    Catálogo: VG40037-CY
    Preço de catálogo: 
    Preço:      (You Save: )
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.