Encomenda rápida

Humano respiratory syncytial virus (RSV) (subtype A, strain Long) glycoprotein G / RSV-G (Codon Optimized) ORF mammalian expression plasmid, N-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
RSV RSV-G Informações sobre o produto de clone de cDNA
Tamanho de cDNA:897bp
Descrição de cDNA:Full length Clone DNA of Human RSV (subtype A, strain Long) glycoprotein G / RSV-G with N terminal His tag.
Sinónimo de gene:G, HRSVgp07
Local de restrição:KpnI + XbaI (6kb + 0.99kb)
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:A number of silent mutations were introduced into the DNA sequence in order to increase its protein expression level in mammalian cell system. The translated amino acid sequence is identical with P20895.2.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at ambient temperature for three months.
RSV RSV-G Gene Plasmid Map
Human respiratory syncytial virus (RSV) (subtype A, strain Long) glycoprotein G / RSV-G (Codon Optimized) ORF mammalian expression plasmid, N-His tag
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Humano respiratory syncytial virus (RSV) (subtype A, strain Long) glycoprotein G / RSV-G (Codon Optimized) ORF mammalian expression plasmid, N-His Etiqueta on other vectors
Humano respiratory syncytial virus (RSV) (subtype A, strain Long) glycoprotein G / RSV-G ORF mammalian expression plasmid (Codon Optimized), C-GFPSpark-taggedVG40041-ACG$325
Humano respiratory syncytial virus (RSV) (subtype A, strain Long) glycoprotein G / RSV-G (Codon Optimized) ORF mammalian expression plasmid, C-OFPSpark / RFP EtiquetaVG40041-ACR$325
Humano respiratory syncytial virus (RSV) (subtype A, strain Long) glycoprotein G / RSV-G ORF mammalian expression plasmid (Codon Optimized), C-Flag EtiquetaVG40041-CF$295
Humano respiratory syncytial virus (RSV) (subtype A, strain Long) glycoprotein G / RSV-G (Codon Optimized) ORF mammalian expression plasmid, C-His EtiquetaVG40041-CH$295
Humano respiratory syncytial virus (RSV) (subtype A, strain Long) glycoprotein G / RSV-G (Codon Optimized) ORF mammalian expression plasmid, C-Myc EtiquetaVG40041-CM$295
Humano respiratory syncytial virus (RSV) (subtype A, strain Long) glycoprotein G / RSV-G (Codon Optimized) ORF mammalian expression plasmid, C-HA EtiquetaVG40041-CY$295
Humano respiratory syncytial virus (RSV) (subtype A, strain Long) glycoprotein G / RSV-G ORF mammalian expression plasmid (Codon Optimized)VG40041-G$95
Humano respiratory syncytial virus (RSV) (subtype A, strain Long) glycoprotein G / RSV-G (Codon Optimized) ORF mammalian expression plasmid, N-Flag EtiquetaVG40041-NF$295
Humano respiratory syncytial virus (RSV) (subtype A, strain Long) glycoprotein G / RSV-G (Codon Optimized) ORF mammalian expression plasmid, N-His EtiquetaVG40041-NH$295
Humano respiratory syncytial virus (RSV) (subtype A, strain Long) glycoprotein G / RSV-G ORF mammalian expression plasmid (Codon Optimized), N-Myc-taggedVG40041-NM$295
Humano respiratory syncytial virus (RSV) (subtype A, strain Long) glycoprotein G / RSV-G (Codon Optimized) ORF mammalian expression plasmid, N-HA EtiquetaVG40041-NY$295
Humano respiratory syncytial virus (RSV) (subtype A, strain Long) glycoprotein G / RSV-G ORF mammalian expression plasmid (Codon Optimized)VG40041-UT$295
 Saiba mais sobre vectores de expressão
Product nameProduct name

Human respiratory syncytial virus (HRSV) is the most common etiological agent of acute lower respiratory tract disease in infants and can cause repeated infections throughout life. It is classified within the genus pneumovirus of the family paramyxoviridae. Like other members of the family, HRSV has two major surface glycoproteins (G and F) that play important roles in the initial stages of the infectious cycle. HRSV G protein is a type II glycoprotein of 289-299 amino acids (depending on the virus strain) with a signal/anchor hydrophobic domain and is extensively modified by the addition of both N-and O-linked oligosaccharides to achieve the mature form of 80-90 kDa. The C-terminal ectodomain of the G protein has a central region and four cysteines which are conserved in all HRSV isolates and have been proposed as the putative receptor binding site. The G protein mediates attachment of the virus to the host cell membrane by interacting with heparan sulfate, initiating the infection. As similar to mucins in amino acid compositions, the RSV G protein can interact with host CX3CR1, the receptor for the CX3C chemokine fractalkine, and thus modulates the immune response and facilitate infection. Secreted glycoprotein G helps RSV escape antibody-dependent restriction of replication by acting as an antigen decoy and by modulating the activity of leukocytes bearing Fcgamma receptors. Unlike the other paramyxovirus attachment proteins, HRSV-G lacks both neuraminidase and hemagglutinating activities.

  • Martin-Gallardo A. et al., 1993, J Gen Virol. 74 : 453-8.
  • Jose AM. et al.,1997, J Gen Virol. 78: 2411-8.
  • Feldman SA. et al., 1999, J Virol. 73: 6610-7.
  • García-Beato R. et al., 2000, J Gen Virol. 81: 919-27.
  • Zlateva KT. et al., 2004, J Virol. 78: 4675-83.
  • Trento A. et al., 2006, J Virol. 80: 975-84.
  • Size / Price
    Catálogo: VG40041-NH
    Preço de catálogo: 
    Preço:      (You Save: )
    DisponibilidadeIn Stock
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
    • Human respiratory syncytial virus (RSV) (subtype A, strain Long) glycoprotein G / RSV-G (Codon Optimized) ORF mammalian expression plasmid, N-His tag
      Itens recentemente visualizados
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.