After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Encomenda rápida

Text Size:AAA

Humano NRG1/Neuregulin 1 transcript variant HRG-beta2 clonagem de ADN ou de clonagem do gene (vector de clonagem)

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human NRG1 Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_013957.3
Tamanho de cDNA:1914bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens neuregulin 1 transcript variant HRG-beta2.
Sinónimo de gene:GGF, HGL, HRG, NDF, ARIA, GGF2, HRG1, HRGA, SMDF
Espécie:Human
Vetor:pCMV3-untagged
Plasmid:
Local de restrição:
Sequência de etiqueta:
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Humano NRG1/Neuregulin 1 transcript variant HRG-beta2 clonagem de ADN ou de clonagem do gene (vector de clonagem) on other vectors
Humano NRG1/Neuregulin 1 transcript variant HRG-beta2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG10658-ACG$245
Humano NRG1/Neuregulin 1 transcript variant HRG-beta2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG10658-ACR$245
Humano NRG1/Neuregulin 1 transcript variant HRG-beta2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG10658-CF$215
Humano NRG1/Neuregulin 1 transcript variant HRG-beta2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG10658-CH$215
Humano NRG1/Neuregulin 1 transcript variant HRG-beta2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG10658-CM$215
Humano NRG1/Neuregulin 1 transcript variant HRG-beta2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG10658-CY$215
Humano NRG1/Neuregulin 1 transcript variant HRG-beta2 clonagem de ADN ou de clonagem do gene (vector de expressão)HG10658-M$75
Humano NRG1/Neuregulin 1 transcript variant HRG-beta2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG10658-NF$215
Humano NRG1/Neuregulin 1 transcript variant HRG-beta2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG10658-NH$215
Humano NRG1/Neuregulin 1 transcript variant HRG-beta2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG10658-NM$215
Humano NRG1/Neuregulin 1 transcript variant HRG-beta2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG10658-NY$215
Humano NRG1/Neuregulin 1 transcript variant HRG-beta2 clonagem de ADN ou de clonagem do gene (vector de clonagem)HG10658-UT$215
 Saiba mais sobre vectores de expressão
Product nameProduct name
Fundo

Neuregulin 1 or NRG1 is one of four proteins in the neuregulin family that act on the EGFR family of receptors. This growth factor was originally identified as a 44-kD glycoprotein that interacts with the NEU / ERBB2 receptor tyrosine kinase to increase its phosphorylation on tyrosine residues. NRG1 is a trophic factor that has been implicated in neural development, neurotransmission, and synaptic plasticity. NRG1 has multiple isoforms that are generated by usage of different promoters and alternative splicing of a single gene. Neuregulin 1 (NRG1) is essential for the development and function of multiple organ systems, and its dysregulation has been linked to diseases such as cancer and schizophrenia. NRG1 is a schizophrenia candidate gene and plays an important role in brain development and neural function. Schizophrenia is a complex disorder, with etiology likely due to epistasis. 

Referências
  • Nicodemus KK, et al. (2010) Biological validation of increased schizophrenia risk with NRG1, ERBB4, and AKT1 epistasis via functional neuroimaging in healthy controls. Arch Gen Psychiatry. 67 (10): 991-1001.
  • Tan W, et al. (2007) Molecular cloning of a brain-specific, developmentally regulated neuregulin 1 (NRG1) isoform and identification of a functional promoter variant associated with schizophrenia. J Biol Chem. 282 (33): 24343-51.
  • Holmes WE, et al. (1992) Identification of heregulin, a specific activator of p185erbB2. Science. 256 (5060): 1205-10.
  • Size / Price
    Catálogo: HG10658-UT
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"