Encomenda rápida

Humano NRG1/Neuregulin 1 transcript variant HRG-beta2 clonagem de ADN ou de clonagem do gene (vector de clonagem)

    Folha de dadosAnálisesProdutos relacionadosProtocolos
    Humano NRG1 Informações sobre o produto de clone de cDNA
    Gene_bank_ref_id:NM_013957.3
    Tamanho de cDNA:1914bp
    Descrição de cDNA:Full length Clone DNA of Homo sapiens neuregulin 1 transcript variant HRG-beta2.
    Sinónimo de gene:GGF, HGL, HRG, NDF, ARIA, GGF2, HRG1, HRGA, SMDF
    Espécie:Human
    Vetor:pCMV3-untagged
    Plasmid:
    Local de restrição:
    Sequência de etiqueta:
    Descrição da sequência:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with NRG1 qPCR primers for gene expression analysis, HP100872 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
    Humano NRG1/Neuregulin 1 transcript variant HRG-beta2 clonagem de ADN ou de clonagem do gene (vector de clonagem) on other vectors
    Humano NRG1/Neuregulin 1 transcript variant HRG-beta2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG10658-ACG$245
    Humano NRG1/Neuregulin 1 transcript variant HRG-beta2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG10658-ACR$245
    Humano NRG1/Neuregulin 1 transcript variant HRG-beta2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG10658-CF$215
    Humano NRG1/Neuregulin 1 transcript variant HRG-beta2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG10658-CH$215
    Humano NRG1/Neuregulin 1 transcript variant HRG-beta2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG10658-CM$215
    Humano NRG1/Neuregulin 1 transcript variant HRG-beta2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG10658-CY$215
    Humano NRG1/Neuregulin 1 transcript variant HRG-beta2 clonagem de ADN ou de clonagem do gene (vector de expressão)HG10658-M$75
    Humano NRG1/Neuregulin 1 transcript variant HRG-beta2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG10658-NF$215
    Humano NRG1/Neuregulin 1 transcript variant HRG-beta2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG10658-NH$215
    Humano NRG1/Neuregulin 1 transcript variant HRG-beta2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG10658-NM$215
    Humano NRG1/Neuregulin 1 transcript variant HRG-beta2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG10658-NY$215
    Humano NRG1/Neuregulin 1 transcript variant HRG-beta2 clonagem de ADN ou de clonagem do gene (vector de clonagem)HG10658-UT$215
     Saiba mais sobre vectores de expressão
    Product nameProduct name
    Fundo

    Neuregulin 1 or NRG1 is one of four proteins in the neuregulin family that act on the EGFR family of receptors. This growth factor was originally identified as a 44-kD glycoprotein that interacts with the NEU / ERBB2 receptor tyrosine kinase to increase its phosphorylation on tyrosine residues. NRG1 is a trophic factor that has been implicated in neural development, neurotransmission, and synaptic plasticity. NRG1 has multiple isoforms that are generated by usage of different promoters and alternative splicing of a single gene. Neuregulin 1 (NRG1) is essential for the development and function of multiple organ systems, and its dysregulation has been linked to diseases such as cancer and schizophrenia. NRG1 is a schizophrenia candidate gene and plays an important role in brain development and neural function. Schizophrenia is a complex disorder, with etiology likely due to epistasis. 

    Referências
  • Nicodemus KK, et al. (2010) Biological validation of increased schizophrenia risk with NRG1, ERBB4, and AKT1 epistasis via functional neuroimaging in healthy controls. Arch Gen Psychiatry. 67 (10): 991-1001.
  • Tan W, et al. (2007) Molecular cloning of a brain-specific, developmentally regulated neuregulin 1 (NRG1) isoform and identification of a functional promoter variant associated with schizophrenia. J Biol Chem. 282 (33): 24343-51.
  • Holmes WE, et al. (1992) Identification of heregulin, a specific activator of p185erbB2. Science. 256 (5060): 1205-10.
  • Size / Price
    Catálogo: HG10658-UT
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade
    Acrescentar a carrinhoBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
      Itens recentemente visualizados
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"