Encomenda rápida

Humano eIF2A/eIF2 alpha clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human EIF2A Informações sobre o produto de clone de cDNA
Tamanho de cDNA:1758bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens eukaryotic translation initiation factor 2A, 65kDa (EIF2A) with N terminal His tag.
Sinónimo de gene:EIF2A, CDA02, EIF-2A, MST089, MSTP004, MSTP089
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Humano eIF2A/eIF2 alpha clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta on other vectors
Humano eIF2A/eIF2 alpha clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG10112-ACG$245
Humano eIF2A/eIF2 alpha clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG10112-ACR$245
Humano eIF2A/eIF2 alpha clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaHG10112-ANG$245
Humano eIF2A/eIF2 alpha clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaHG10112-ANR$245
Humano eIF2A/eIF2 alpha clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG10112-CF$215
Humano eIF2A/eIF2 alpha clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG10112-CH$215
Humano eIF2A/eIF2 alpha clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG10112-CM$215
Humano eIF2A/eIF2 alpha clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG10112-CY$215
Humano eIF2A/eIF2 alpha clonagem de ADN ou de clonagem do gene (vector de expressão)HG10112-M$75
Humano eIF2A/eIF2 alpha clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG10112-M-F$215
Humano eIF2A/eIF2 alpha clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG10112-NF$215
Humano eIF2A/eIF2 alpha clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG10112-NH$215
Humano eIF2A/eIF2 alpha clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG10112-NM$215
Humano eIF2A/eIF2 alpha clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG10112-NY$215
Humano eIF2A/eIF2 alpha clonagem de ADN ou de clonagem do gene (vector de clonagem)HG10112-UT$215
 Saiba mais sobre vectores de expressão
Product nameProduct name
Size / Price
Catálogo: HG10112-NH
Preço de catálogo: 
Preço:      (You Save: )
Disponibilidade2-3 weeks
Bulk Discount RequiryAcrescentar a carrinho
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.