Encomenda rápida

Humano eIF2A/eIF2 alpha clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Humano EIF2A Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_032025.3
Tamanho de cDNA:1758bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens eukaryotic translation initiation factor 2A, 65kDa (EIF2A) with N terminal His tag.
Sinónimo de gene:EIF2A, CDA02, EIF-2A, MST089, MSTP004, MSTP089
Espécie:Human
Vetor:pCMV3-N-His
Plasmid:
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with eIF2a qPCR primers for gene expression analysis, HP100187 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Humano eIF2A/eIF2 alpha clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta on other vectors
Humano eIF2A/eIF2 alpha clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG10112-ACG$245
Humano eIF2A/eIF2 alpha clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG10112-ACR$245
Humano eIF2A/eIF2 alpha clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaHG10112-ANG$245
Humano eIF2A/eIF2 alpha clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaHG10112-ANR$245
Humano eIF2A/eIF2 alpha clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG10112-CF$215
Humano eIF2A/eIF2 alpha clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG10112-CH$215
Humano eIF2A/eIF2 alpha clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG10112-CM$215
Humano eIF2A/eIF2 alpha clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG10112-CY$215
Humano eIF2A/eIF2 alpha clonagem de ADN ou de clonagem do gene (vector de expressão)HG10112-M$75
Humano eIF2A/eIF2 alpha clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG10112-M-F$215
Humano eIF2A/eIF2 alpha clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG10112-NF$215
Humano eIF2A/eIF2 alpha clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG10112-NH$215
Humano eIF2A/eIF2 alpha clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG10112-NM$215
Humano eIF2A/eIF2 alpha clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG10112-NY$215
Humano eIF2A/eIF2 alpha clonagem de ADN ou de clonagem do gene (vector de clonagem)HG10112-UT$215
 Saiba mais sobre vectores de expressão
Product nameProduct name
Size / Price
Catálogo: HG10112-NH
Preço de catálogo: 
Preço:      (You Save: )
Tamanho:
Quantidade:+-
Disponibilidade
Acrescentar a carrinhoBulk Discount Requiry
Contact Us
Imagens
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"