After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Humano XCL1 clonagem de ADN ou de clonagem do gene (vector de clonagem)

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human XCL1 Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_002995.1
Tamanho de cDNA:345bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens chemokine (C motif) ligand 1.
Sinónimo de gene:LTN, ATAC, LPTN, SCM1, SCM-1, SCYC1, SCM-1a, XCL1
Espécie:Human
Vetor:pCMV3-untagged
Plasmid:pCMV3-XCL1
Local de restrição:KpnI + XbaI (6.1kb + 0.35kb)
Sequência de etiqueta:
Descrição da sequência:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Human XCL1 Gene Plasmid Map
Human XCL1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Product nameProduct name
Referências
  • Nguyen KD, et al. (2008) XCL1 enhances regulatory activities of CD4+ CD25(high) CD127(low/-) T cells in human allergic asthma. J Immunol. 181 (8): 5386-95.
  • Dong C, et al. (2005) Glycosylated recombinant human XCL1 / lymphotactin exhibits enhanced biologic activity. J Immunol Methods. 302 (1-2): 136-44.
  • Zavala-Flores LM, et al. (2009) Production of biologically active human lymphotactin (XCL1) by Lactococcus lactis. Biotechnol Lett. 31 (2): 215-20.
  • Size / Price
    Catálogo: HG10672-UT
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    DisponibilidadeIn Stock
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
    Imagens
    • Human XCL1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      Itens recentemente visualizados
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"