After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Encomenda rápida

Text Size:AAA

Humano WTAP clonagem de ADN ou de clonagem do gene (vector de clonagem)

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human WTAP Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_152857
Tamanho de cDNA:1191bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens Wilms tumor 1 associated protein.
Sinónimo de gene:KIAA0105, MGC3925
Espécie:Human
Vetor:pCMV3-untagged
Plasmid:pCMV3-WTAP
Local de restrição:KpnI + XbaI (6.1kb + 1.19kb)
Sequência de etiqueta:
Descrição da sequência:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Human WTAP Gene Plasmid Map
Human WTAP Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Humano WTAP clonagem de ADN ou de clonagem do gene (vector de clonagem) on other vectors
Humano WTAP clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG12018-ACG$225
Humano WTAP clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG12018-ACR$225
Humano WTAP clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaHG12018-ANG$225
Humano WTAP clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaHG12018-ANR$225
Humano WTAP clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG12018-CF$195
Humano WTAP clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG12018-CH$195
Humano WTAP clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG12018-CM$195
Humano WTAP clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG12018-CY$195
Humano WTAP clonagem de ADN ou de clonagem do gene (vector de expressão)HG12018-G$75
Humano WTAP clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG12018-G-F$195
Humano WTAP clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG12018-NF$195
Humano WTAP clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG12018-NH$195
Humano WTAP clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG12018-NM$195
Humano WTAP clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG12018-NY$195
Humano WTAP clonagem de ADN ou de clonagem do gene (vector de clonagem)HG12018-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
Fundo

Wilms' tumor 1-associating protein (WTAP) was previously identified as a protein associated with Wilms' tumor-1 (WT-1) protein that is essential for the development of the genitourinary system. WT1 was originally identified as a tumor suppressor for Wilms' tumor, but it is also overexpressed in a variety of cancer cells. The WTAP-WT1 axis in vascular cells suggest that WTAP is a vital and multifaceted regulator of vascular remodeling. WTAP has been suggested to function in alternative splicing, stabilization of mRNA, and cell growth. Knocking down endogenous WTAP increased Smooth muscle cells (SMCs) proliferation, because of increased DNA synthesis and G(1)/S phase transition, together with reduced apoptosis. These effects could be the result of WTAP suppressing the transcriptional activity of WT1 in SMCs. WTAP may thus also play a role in messenger RNA processing in mammalian cells, either dependent on or independent of its interaction with WT1.

Referências
  • Fukusumi Y, et al. (2008) Wtap is required for differentiation of endoderm and mesoderm in the mouse embryo. Dev Dyn. 237(3): 618-29.
  • Small TW, et al. (2007) Vascular biology and the sex of flies: regulation of vascular smooth muscle cell proliferation by wilms' tumor 1-associating protein. Trends Cardiovasc Med. 17(7): 230-4.
  • Small TW, et al. (2006) Wilms' tumor 1-associating protein regulates the proliferation of vascular smooth muscle cells. Circ Res. 99(12): 1338-46.
  • Rong Y, et al. (2006) Wilms' tumor 1 and signal transducers and activators of transcription 3 synergistically promote cell proliferation: a possible mechanism in sporadic Wilms' tumor. Cancer Res. 66(16): 8049-57.
  • Size / Price
    Catálogo: HG12018-UT
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    DisponibilidadeIn Stock
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
    Imagens
    • Human WTAP Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      Itens recentemente visualizados
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"