Encomenda rápida

Text Size:AAA

Humano Wnt11 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human WNT11 Informações sobre o produto de clone de cDNA
Tamanho de cDNA:1065bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens wingless-type MMTV integration site family, member 11 with C terminal His tag.
Sinónimo de gene:WNT11
Local de restrição:KpnI + XbaI (6kb + 1.12kb)
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Human WNT11 Gene Plasmid Map
Human WNT11 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Size / Price
Catálogo: HG12056-CH
Preço de catálogo: 
Preço:      (You Save: )
DisponibilidadeIn Stock
Bulk Discount RequiryAcrescentar a carrinho
Contact Us
  • Human WNT11 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.