Encomenda rápida

Humano Wnt4 clonagem de ADN ou de clonagem do gene (vector de clonagem)

  • Human WNT-4 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Folha de dadosAnálisesProdutos relacionadosProtocolos
Humano WNT4 Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_030761.4
Tamanho de cDNA:1056bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens wingless-type MMTV integration site family, member 4.
Sinónimo de gene:WNT-4, SERKAL, WNT4
Espécie:Human
Vetor:pCMV3-untagged
Plasmid:pCMV3-WNT4
Local de restrição:KpnI + XbaI (6.1kb + 1.06kb)
Sequência de etiqueta:
Descrição da sequência:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with Wnt4 qPCR primers for gene expression analysis, HP100640 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicillin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Humano WNT4 Gene Plasmid Map
Human WNT-4 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Product nameProduct name
Size / Price
Catálogo: HG10674-UT
Preço de catálogo: 
Preço:      (You Save: )
Tamanho:
Quantidade:+-
Disponibilidade
Acrescentar a carrinhoBulk Discount Requiry

Datasheet & Documentation

Contact Us
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"