Encomenda rápida

Text Size:AAA

Humano DUSP3/VHR clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human DUSP3 Informações sobre o produto de clone de cDNA
Tamanho de cDNA:558bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens dual specificity phosphatase 3 with N terminal His tag.
Sinónimo de gene:DUSP3, VHR
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Humano DUSP3/VHR clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta on other vectors
Humano DUSP3/VHR clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG10114-ACG$225
Humano DUSP3/VHR clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG10114-ACR$225
Humano DUSP3/VHR clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaHG10114-ANG$225
Humano DUSP3/VHR clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaHG10114-ANR$225
Humano DUSP3/VHR clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG10114-CF$195
Humano DUSP3/VHR clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG10114-CH$195
Humano DUSP3/VHR clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG10114-CM$195
Humano DUSP3/VHR clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG10114-CY$195
Humano DUSP3/VHR clonagem de ADN ou de clonagem do gene (vector de expressão)HG10114-M$75
Humano DUSP3/VHR clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG10114-NF$195
Humano DUSP3/VHR clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG10114-NH$195
Humano DUSP3/VHR clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG10114-NM$195
Humano DUSP3/VHR clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG10114-NY$195
Humano DUSP3/VHR clonagem de ADN ou de clonagem do gene (vector de clonagem)HG10114-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name

Vaccinia H1-related phosphatase (VHR) is classified as a dual-specificity phosphatase (DUSP), and the other name is dual-specificity phosphatase 3 (DUSP3). DUSPs are a heterogeneous group of protein phosphatases that can dephosphorylate both phosphotyrosine and phosphoserine/phosphothreonine residues within the one substrate. Unlike typical DUSPs, VHR lacks mitogen-activated protein kinase (MAPK)-binding domain, and shows poor activity against MAPKs. VHR often act on bisphosphorylated protein substrates, it displays a strong preference for dephosphorylating phosphotyrosine residues over phosphothreonine residues. VHR has been identified as a novel regulator of extracellular regulated kinases (ERKs). VHR is responsible for the rapid inactivation of ERK following stimulation and for its repression in quiescent cells. VHR is a negative regulator of the Erk and Jnk pathways in T cells and, therefore, may play a role in aspects of T lymphocyte physiology that depend on these kinases.

  • Todd J.L, et al. (1999) Extracellular regulated kinases (ERK) 1 and ERK2 are authentic substrates for the dual-specificity protein-tyrosine phosphatase VHR. A novel role in down-regulating the ERK pathway. J. Biol. Chem. 274: 13271-80.
  • Alonso A, et al. (2001) Inhibitory role for dual specificity phosphatase VHR in T cell antigen receptor and CD28-induced Erk and Jnk activation. J Biol Chem. 276(7): 4766-71.
  • Schumacher MA, et al. (2002) Structural basis for the recognition of a bisphosphorylated MAP kinase peptide by human VHR protein Phosphatase. Biochemistry. 41(9): 3009-17.
  • Patterson KI, et al. (2009) Dual-specificity phosphatases: critical regulators with diverse cellular targets. Biochem J. 2009 Mar 15;418(3): 475-89.
  • Size / Price
    Catálogo: HG10114-NH
    Preço de catálogo: 
    Preço:      (You Save: )
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
        Itens recentemente visualizados
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.