After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Encomenda rápida

Text Size:AAA

Humano DUSP3/VHR clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human DUSP3 Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_004090.3
Tamanho de cDNA:558bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens dual specificity phosphatase 3 with N terminal His tag.
Sinónimo de gene:DUSP3, VHR
Espécie:Human
Vetor:pCMV3-N-His
Plasmid:
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Humano DUSP3/VHR clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta on other vectors
Humano DUSP3/VHR clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG10114-ACG$225
Humano DUSP3/VHR clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG10114-ACR$225
Humano DUSP3/VHR clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaHG10114-ANG$225
Humano DUSP3/VHR clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaHG10114-ANR$225
Humano DUSP3/VHR clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG10114-CF$195
Humano DUSP3/VHR clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG10114-CH$195
Humano DUSP3/VHR clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG10114-CM$195
Humano DUSP3/VHR clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG10114-CY$195
Humano DUSP3/VHR clonagem de ADN ou de clonagem do gene (vector de expressão)HG10114-M$75
Humano DUSP3/VHR clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG10114-NF$195
Humano DUSP3/VHR clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG10114-NH$195
Humano DUSP3/VHR clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG10114-NM$195
Humano DUSP3/VHR clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG10114-NY$195
Humano DUSP3/VHR clonagem de ADN ou de clonagem do gene (vector de clonagem)HG10114-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
Fundo

Vaccinia H1-related phosphatase (VHR) is classified as a dual-specificity phosphatase (DUSP), and the other name is dual-specificity phosphatase 3 (DUSP3). DUSPs are a heterogeneous group of protein phosphatases that can dephosphorylate both phosphotyrosine and phosphoserine/phosphothreonine residues within the one substrate. Unlike typical DUSPs, VHR lacks mitogen-activated protein kinase (MAPK)-binding domain, and shows poor activity against MAPKs. VHR often act on bisphosphorylated protein substrates, it displays a strong preference for dephosphorylating phosphotyrosine residues over phosphothreonine residues. VHR has been identified as a novel regulator of extracellular regulated kinases (ERKs). VHR is responsible for the rapid inactivation of ERK following stimulation and for its repression in quiescent cells. VHR is a negative regulator of the Erk and Jnk pathways in T cells and, therefore, may play a role in aspects of T lymphocyte physiology that depend on these kinases.

Referências
  • Todd J.L, et al. (1999) Extracellular regulated kinases (ERK) 1 and ERK2 are authentic substrates for the dual-specificity protein-tyrosine phosphatase VHR. A novel role in down-regulating the ERK pathway. J. Biol. Chem. 274: 13271-80.
  • Alonso A, et al. (2001) Inhibitory role for dual specificity phosphatase VHR in T cell antigen receptor and CD28-induced Erk and Jnk activation. J Biol Chem. 276(7): 4766-71.
  • Schumacher MA, et al. (2002) Structural basis for the recognition of a bisphosphorylated MAP kinase peptide by human VHR protein Phosphatase. Biochemistry. 41(9): 3009-17.
  • Patterson KI, et al. (2009) Dual-specificity phosphatases: critical regulators with diverse cellular targets. Biochem J. 2009 Mar 15;418(3): 475-89.
  • Size / Price
    Catálogo: HG10114-NH
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
    Imagens
        Itens recentemente visualizados
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"