Encomenda rápida

Humano VDR-NR111 clonagem de ADN ou de clonagem do gene (vector de clonagem)

    Folha de dadosAnálisesProdutos relacionadosProtocolos
    Humano VDR Informações sobre o produto de clone de cDNA
    Gene_bank_ref_id:NM_000376.2
    Tamanho de cDNA:1284bp
    Descrição de cDNA:Full length Clone DNA of Homo sapiens vitamin D (1,25- dihydroxyvitamin D3) receptor.
    Sinónimo de gene:NR1I1, VDR
    Espécie:Human
    Vetor:pCMV3-untagged
    Plasmid:
    Local de restrição:
    Sequência de etiqueta:
    Descrição da sequência:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with VDR qPCR primers for gene expression analysis, HP101561 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
    Humano VDR-NR111 clonagem de ADN ou de clonagem do gene (vector de clonagem) on other vectors
    Humano VDR-NR111 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG12025-ACG$225
    Humano VDR-NR111 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG12025-ACR$225
    Humano VDR-NR111 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaHG12025-ANG$225
    Humano VDR-NR111 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaHG12025-ANR$225
    Humano VDR-NR111 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG12025-CF$195
    Humano VDR-NR111 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG12025-CH$195
    Humano VDR-NR111 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG12025-CM$195
    Humano VDR-NR111 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG12025-CY$195
    Humano VDR-NR111 clonagem de ADN ou de clonagem do gene (vector de expressão)HG12025-G$75
    Humano VDR-NR111 clonagem de ADN ou de clonagem do gene (vector de clonagem)HG12025-G-N$195
    Humano VDR-NR111 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG12025-NF$195
    Humano VDR-NR111 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG12025-NH$195
    Humano VDR-NR111 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG12025-NM$195
    Humano VDR-NR111 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG12025-NY$195
    Humano VDR-NR111 clonagem de ADN ou de clonagem do gene (vector de clonagem)HG12025-UT$195
     Saiba mais sobre vectores de expressão
    Product nameProduct name
    Fundo

    VDR (vitamin D(1,25- dihydroxyvitamin D3)receptor), also known as NR1I1, belongs to the NR1I family, NR1 subfamily. It is composed of three domains: a modulating N-terminal domain, a DNA-binding domain and a C-terminal ligand-binding domain. Vitamin D receptors (VDRs) are members of the NR1I family, which also includes pregnane X (PXR) and constitutive androstane (CAR) receptors, that form heterodimers with members of the retinoid X receptor family. VDRs repress expression of 1alpha-hydroxylase (the proximal activator of 1,25(OH)2D3) and induce expression of the 1,25(OH)2D3 inactivating enzyme CYP24. Also, it has recently been identified as an additional bile acid receptor alongside FXR and may function to protect gut against the toxic and carcinogenic effects of these endobiotics. VDR is expressed in the intestine, thyroid and kidney and has a vital role in calcium homeostasis. It is the nuclear hormone receptor, also called transcription factor that mediates the action of vitamin D3. Inherited mutations in the VDR gene leads to rickets.

    Referências
  • Moore DD, et al. (2006) The NR1H and NR1I receptors: constitutive androstane receptor, pregnene X receptor, farnesoid X receptor alpha, farnesoid X receptor beta, liver X receptor alpha, liver X receptor beta, and vitamin D receptor. Pharmacol Rev. 58(4):742-59.
  • Szpirer J, et al. (1991)The Sp1 transcription factor gene (SP1) and the 1,25-dihydroxyvitamin D3 receptor gene (VDR) are colocalized on human chromosome arm 12q and rat chromosome 7. Genomics. 11(1):168-73.
  • Germain P, et al. (2006) Overview of nomenclature of nuclear receptors. Pharmacol Rev. 58(4): 685-704.
  • Adorini L, et al. (2006) Vitamin D receptor agonists, cancer and the immune system: an intricate relationship. Curr Top Med Chem. 6(12):1297-301.
  • Luderer HF, et al. (2010) The vitamin D receptor, the skin and stem cells. J Steroid Biochem Mol Biol. 121(1-2):314-6.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"