Encomenda rápida

Humano VAPB/VAP-B clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human VAPB Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_004738.3
Tamanho de cDNA:732bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens VAMP (vesicle-associated membrane protein)-associated protein B and C with N terminal His tag.
Sinónimo de gene:ALS8, VAP-B, VAP-C, VAMP-B, VAMP-C, VAPB
Espécie:Human
Vetor:pCMV3-N-His
Plasmid:
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Humano VAPB/VAP-B clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta on other vectors
Humano VAPB/VAP-B clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG10754-ACG$225
Humano VAPB/VAP-B clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG10754-ACR$225
Humano VAPB/VAP-B clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaHG10754-ANG$225
Humano VAPB/VAP-B clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaHG10754-ANR$225
Humano VAPB/VAP-B clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG10754-CF$195
Humano VAPB/VAP-B clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG10754-CH$195
Humano VAPB/VAP-B clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG10754-CM$195
Humano VAPB/VAP-B clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG10754-CY$195
Humano VAPB/VAP-B clonagem de ADN ou de clonagem do gene (vector de expressão)HG10754-M$75
Humano VAPB/VAP-B clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG10754-M-F$195
Humano VAPB/VAP-B clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG10754-NF$195
Humano VAPB/VAP-B clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG10754-NH$195
Humano VAPB/VAP-B clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG10754-NM$195
Humano VAPB/VAP-B clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG10754-NY$195
Humano VAPB/VAP-B clonagem de ADN ou de clonagem do gene (vector de clonagem)HG10754-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
Fundo

Vesicle-associated membrane protein-associated protein B / C, also known as VAMP-B/VAMP-C, VAMP-associated protein B/C, VAP-B/VAP-C and VAPB, is a single-pass type IV membrane protein which belongs to the VAMP-associated protein ( VAP ) family. VAPB contains one MSP domain. VAPB may play a role in vesicle trafficking. VAPB forms a heterodimer with VAPA. VAPB interacts with VAMP1 and VAMP2. Defects in VAPB are the cause of amyotrophic lateral sclerosis type 8 ( ALS8 ) which is a familial form of amyotrophic lateral sclerosis, a neurodegenerative disorder affecting upper and lower motor neurons and resulting in fatal paralysis. Defects in VAPB are also a cause of spinal muscular atrophy autosomal dominant Finkel type ( SMAF ) which is characterized by proximal muscle weakness that begins in the lower limbs and then progresses to upper limbs.

Referências
  • Nishimura Y., et al., 1999, Biochem. Biophys. Res. Commun. 254:21-26.
  • Gevaert K., et al., 2003, Nat. Biotechnol. 21:566-569.
  • Hamamoto I., et al., 2005, J. Virol. 79:13473-13482.
  • Choudhary C. et al., 2009, Science 325:834-840.
  • Size / Price
    Catálogo: HG10754-NH
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
    Imagens
        Itens recentemente visualizados
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"