Encomenda rápida

Text Size:AAA

Humano VAPB/VAP-B clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human VAPB Informações sobre o produto de clone de cDNA
Tamanho de cDNA:732bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens VAMP (vesicle-associated membrane protein)-associated protein B and C with N terminal His tag.
Sinónimo de gene:ALS8, VAP-B, VAP-C, VAMP-B, VAMP-C, VAPB
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Humano VAPB/VAP-B clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta on other vectors
Humano VAPB/VAP-B clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG10754-ACG$225
Humano VAPB/VAP-B clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG10754-ACR$225
Humano VAPB/VAP-B clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaHG10754-ANG$225
Humano VAPB/VAP-B clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaHG10754-ANR$225
Humano VAPB/VAP-B clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG10754-CF$195
Humano VAPB/VAP-B clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG10754-CH$195
Humano VAPB/VAP-B clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG10754-CM$195
Humano VAPB/VAP-B clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG10754-CY$195
Humano VAPB/VAP-B clonagem de ADN ou de clonagem do gene (vector de expressão)HG10754-M$75
Humano VAPB/VAP-B clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG10754-M-F$195
Humano VAPB/VAP-B clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG10754-NF$195
Humano VAPB/VAP-B clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG10754-NH$195
Humano VAPB/VAP-B clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG10754-NM$195
Humano VAPB/VAP-B clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG10754-NY$195
Humano VAPB/VAP-B clonagem de ADN ou de clonagem do gene (vector de clonagem)HG10754-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name

Vesicle-associated membrane protein-associated protein B / C, also known as VAMP-B/VAMP-C, VAMP-associated protein B/C, VAP-B/VAP-C and VAPB, is a single-pass type IV membrane protein which belongs to the VAMP-associated protein ( VAP ) family. VAPB contains one MSP domain. VAPB may play a role in vesicle trafficking. VAPB forms a heterodimer with VAPA. VAPB interacts with VAMP1 and VAMP2. Defects in VAPB are the cause of amyotrophic lateral sclerosis type 8 ( ALS8 ) which is a familial form of amyotrophic lateral sclerosis, a neurodegenerative disorder affecting upper and lower motor neurons and resulting in fatal paralysis. Defects in VAPB are also a cause of spinal muscular atrophy autosomal dominant Finkel type ( SMAF ) which is characterized by proximal muscle weakness that begins in the lower limbs and then progresses to upper limbs.

  • Nishimura Y., et al., 1999, Biochem. Biophys. Res. Commun. 254:21-26.
  • Gevaert K., et al., 2003, Nat. Biotechnol. 21:566-569.
  • Hamamoto I., et al., 2005, J. Virol. 79:13473-13482.
  • Choudhary C. et al., 2009, Science 325:834-840.
  • Size / Price
    Catálogo: HG10754-NH
    Preço de catálogo: 
    Preço:      (You Save: )
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
        Itens recentemente visualizados
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.