After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Humano Uteroglobin/SCGB1A1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human SCGB1A1 Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_003357.3
Tamanho de cDNA:276bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens secretoglobin, family 1A, member 1 (uteroglobin) with N terminal Myc tag.
Sinónimo de gene:UGB, CC10, CC16, CCSP, SCGB1A1
Espécie:Human
Vetor:pCMV3-SP-N-Myc
Plasmid:
Local de restrição:
Sequência de etiqueta:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Humano Uteroglobin/SCGB1A1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc Etiqueta on other vectors
Humano Uteroglobin/SCGB1A1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG10808-ACG$225
Humano Uteroglobin/SCGB1A1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG10808-ACR$225
Humano Uteroglobin/SCGB1A1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG10808-CF$195
Humano Uteroglobin/SCGB1A1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG10808-CH$195
Humano Uteroglobin/SCGB1A1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG10808-CM$195
Humano Uteroglobin/SCGB1A1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG10808-CY$195
Humano Uteroglobin/SCGB1A1 clonagem de ADN ou de clonagem do gene (vector de expressão)HG10808-M$75
Humano Uteroglobin/SCGB1A1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG10808-M-F$195
Humano Uteroglobin/SCGB1A1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG10808-NF$195
Humano Uteroglobin/SCGB1A1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG10808-NH$195
Humano Uteroglobin/SCGB1A1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG10808-NM$195
Humano Uteroglobin/SCGB1A1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG10808-NY$195
Humano Uteroglobin/SCGB1A1 clonagem de ADN ou de clonagem do gene (vector de clonagem)HG10808-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
Fundo

Uteroglobin (UG), also known as Secretoglobin 1A member 1 (SCGB1A1), Blastokinin, Clara cell secretor protein (CCSP) or Clara cell-specific 10-kDa protein (CC10), is the founding member of the secretoglobin family of small, secreted, disulfide-bridged dimeric proteins found only in mammals. This protein is mainly expressed in lung, with anti-inflammatory/immunomodulatory properties. Previous in vitro studies demonstrated that CCAAT/enhancer-binding proteins (C/EBPs) are the major transcription factors for the regulation of SCGB1A1 gene expression, whereas FOXA1 had a minimum effect on the transcription. Uteroglobin is a multifunctional protein with antiinflammatory/immunomodulatory properties. Uteroglobin inhibits soluble phospholipase A(2) activity and binds and perhaps sequesters hydrophobic ligands such as progesterone, retinols, polychlorinated biphenyls, phospholipids, and prostaglandins. In addition to its antiinflammatory activities, Uteroglobin manifests antichemotactic, antiallergic, antitumorigenic, and embryonic growth-stimulatory activities. The tissue-specific expression of the Uteroglobin gene is regulated by several steroid hormones, although a nonsteroid hormone, prolactin, further augments its expression in the uterus. Based on its anti-inflammatory and antiallergic properties, Uteroglobin is a potential drug target. The mechanism of Uteroglobin action is likely to be even more complex as it also functions via a putative receptor-mediated pathway.

Referências
  • Mukherjee AB, et al. (1999). Uteroglobin: a novel cytokine? Cell Mol Life Sci. 55(5): 771-87.
  • Klug J, et al. (2000). Uteroglobin/Clara cell 10-kDa family of proteins: nomenclature committee report. Ann. N. Y. Acad. Sci. 923: 348-54.
  • Laukaitis CM, et al. (2005). Evolution of the secretoglobins: a genomic and proteomic view. Biological Journal of the Linnean Society. 84 (3): 493-501.
  • Mukherjee AB, et al. (2007). Uteroglobin: a steroid-inducible immunomodulatory protein that founded the Secretoglobin superfamily. Endocr Rev. 28(7): 707-25.
  • Kido T, et al. (2011). FOXA1 plays a role in regulating secretoglobin 1a1 expression in the absence of CCAAT/enhancer binding protein activities in lung in vivo. Am J Physiol Lung Cell Mol Physiol. 300(3): L441-52.
  • Size / Price
    Catálogo: HG10808-NM
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
    Imagens
        Itens recentemente visualizados
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"