Encomenda rápida

Humano UQCRC1 clonagem de ADN ou de clonagem do gene (vector de clonagem)

  • Human IL12A / IL-12A Gene Plasmid Map 5647
Folha de dadosAnálisesProdutos relacionadosProtocolos
Humano UQCRC1 Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_003365.2
Tamanho de cDNA:1443bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens ubiquinol-cytochrome c reductase core protein I.
Sinónimo de gene:QCR1, UQCR1, D3S3191
Espécie:Human
Vetor:pCMV3-untagged
Plasmid:
Local de restrição:
Sequência de etiqueta:
Descrição da sequência:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with UQCRC1 qPCR primers for gene expression analysis, HP104932 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicillin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Humano UQCRC1 clonagem de ADN ou de clonagem do gene (vector de clonagem) on other vectors
Product nameProduct name
Size / Price
Catálogo: HG16163-UT
Preço de catálogo: 
Preço:      (You Save: )
Tamanho:
Quantidade:+-
Disponibilidade
Acrescentar a carrinhoBulk Discount Requiry

Datasheet & Documentation

Contact Us
    Itens recentemente visualizados
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"