Encomenda rápida

Humano E6AP transcript variant 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human UBE3A Informações sobre o produto de clone de cDNA
Tamanho de cDNA:2559bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens ubiquitin protein ligase E3A, transcript variant 1 with C terminal His tag.
Sinónimo de gene:AS, ANCR, E6-AP, HPVE6A, EPVE6AP, FLJ26981, UBE3A
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Humano E6AP transcript variant 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta on other vectors
Humano E6AP transcript variant 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG11130-ACG$325
Humano E6AP transcript variant 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG11130-ACR$325
Humano E6AP transcript variant 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaHG11130-ANG$325
Humano E6AP transcript variant 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaHG11130-ANR$325
Humano E6AP transcript variant 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG11130-CF$295
Humano E6AP transcript variant 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG11130-CH$295
Humano E6AP transcript variant 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG11130-CM$295
Humano E6AP transcript variant 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG11130-CY$295
Humano E6AP transcript variant 1 clonagem de ADN ou de clonagem do gene (vector de expressão)HG11130-M$75
Humano E6AP transcript variant 1 clonagem de ADN ou de clonagem do gene (vector de clonagem)HG11130-M-N$295
Humano E6AP transcript variant 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG11130-NF$295
Humano E6AP transcript variant 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG11130-NH$295
Humano E6AP transcript variant 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG11130-NM$295
Humano E6AP transcript variant 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG11130-NY$295
Humano E6AP transcript variant 1 clonagem de ADN ou de clonagem do gene (vector de clonagem)HG11130-UT$295
 Saiba mais sobre vectores de expressão
Product nameProduct name
Size / Price
Catálogo: HG11130-CH
Preço de catálogo: 
Preço:      (You Save: )
Disponibilidade2-3 weeks
Bulk Discount RequiryAcrescentar a carrinho
Contact Us
      Itens recentemente visualizados
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.