Encomenda rápida

Text Size:AAA

Humano Thioredoxin-2/TXN2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human TXN2 Informações sobre o produto de clone de cDNA
Tamanho de cDNA:501bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens thioredoxin 2 with N terminal His tag.
Sinónimo de gene:MTRX, TRX2, MT-TRX
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Humano Thioredoxin-2/TXN2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta on other vectors
Humano Thioredoxin-2/TXN2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG12557-ACG$225
Humano Thioredoxin-2/TXN2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG12557-ACR$225
Humano Thioredoxin-2/TXN2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaHG12557-ANG$225
Humano Thioredoxin-2/TXN2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaHG12557-ANR$225
Humano Thioredoxin-2/TXN2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG12557-CF$195
Humano Thioredoxin-2/TXN2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG12557-CH$195
Humano Thioredoxin-2/TXN2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG12557-CM$195
Humano Thioredoxin-2/TXN2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG12557-CY$195
Humano Thioredoxin-2/TXN2 clonagem de ADN ou de clonagem do gene (vector de expressão)HG12557-G$75
Humano Thioredoxin-2/TXN2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG12557-NF$195
Humano Thioredoxin-2/TXN2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG12557-NH$195
Humano Thioredoxin-2/TXN2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG12557-NM$195
Humano Thioredoxin-2/TXN2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG12557-NY$195
Humano Thioredoxin-2/TXN2 clonagem de ADN ou de clonagem do gene (vector de clonagem)HG12557-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name

Thioredoxin-2, also known as TXN2, MTRX and TRX2, is a member of the thioredoxin family. Tryparedoxins (TXN) are thioredoxin-related proteins which, as trypanothione:peroxiredoxin oxidoreductases, constitute the trypanothione-dependent antioxidant defense and may also serve as substrates for ribonucleotide reductase in trypanosomatids. Thioredoxin-2 / TXN2 contains one thioredoxin domain. It is widely expressed in adult (at protein level) and fetal tissues. Human Thioredoxin-2 / TXN2 is a small redox protein important in cellular antioxidant defenses, as well as in the regulation of apoptosis. Thioredoxin-2 / TXN2 has an anti-apoptotic function and plays an important role in the regulation of mitochondrial membrane potential. Thioredoxin-2 / TXN2 could be involved in the resistance to anti-tumor agents. It possesses a dithiol-reducing activity. Thioredoxin-2 / TXN2 plays an important role in protecting the mitochondria against oxidative stress and in sensitizing the cells to ROS-induced apoptosis. Mammalian Thioredoxin-2 / TXN2 is a mitochondrial isoform of highly evolutionary conserved thioredoxins. Thioredoxins are small ubiquitous protein-disulfide oxidoreductases implicated in a large variety of biological functions.

  • Chen Y., et al., 2002, J. Biol. Chem. 277: 33242-8.
  • Smeets A., et al., 2005, Protein Sci. 14: 2610-21.
  • Wen,S. et al., 2009, Am J Med Genet A  149A (2): 155-60.
  • Choudhary C., et al., 2009, Science 325: 834-40.
  • Size / Price
    Catálogo: HG12557-NH
    Preço de catálogo: 
    Preço:      (You Save: )
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
        Itens recentemente visualizados
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.