After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Encomenda rápida

Text Size:AAA

Humano Thioredoxin-2/TXN2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human TXN2 Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:BC013726
Tamanho de cDNA:501bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens thioredoxin 2 with N terminal His tag.
Sinónimo de gene:MTRX, TRX2, MT-TRX
Espécie:Human
Vetor:pCMV3-N-His
Plasmid:
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Humano Thioredoxin-2/TXN2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta on other vectors
Humano Thioredoxin-2/TXN2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG12557-ACG$225
Humano Thioredoxin-2/TXN2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG12557-ACR$225
Humano Thioredoxin-2/TXN2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaHG12557-ANG$225
Humano Thioredoxin-2/TXN2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaHG12557-ANR$225
Humano Thioredoxin-2/TXN2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG12557-CF$195
Humano Thioredoxin-2/TXN2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG12557-CH$195
Humano Thioredoxin-2/TXN2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG12557-CM$195
Humano Thioredoxin-2/TXN2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG12557-CY$195
Humano Thioredoxin-2/TXN2 clonagem de ADN ou de clonagem do gene (vector de expressão)HG12557-G$75
Humano Thioredoxin-2/TXN2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG12557-NF$195
Humano Thioredoxin-2/TXN2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG12557-NH$195
Humano Thioredoxin-2/TXN2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG12557-NM$195
Humano Thioredoxin-2/TXN2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG12557-NY$195
Humano Thioredoxin-2/TXN2 clonagem de ADN ou de clonagem do gene (vector de clonagem)HG12557-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
Fundo

Thioredoxin-2, also known as TXN2, MTRX and TRX2, is a member of the thioredoxin family. Tryparedoxins (TXN) are thioredoxin-related proteins which, as trypanothione:peroxiredoxin oxidoreductases, constitute the trypanothione-dependent antioxidant defense and may also serve as substrates for ribonucleotide reductase in trypanosomatids. Thioredoxin-2 / TXN2 contains one thioredoxin domain. It is widely expressed in adult (at protein level) and fetal tissues. Human Thioredoxin-2 / TXN2 is a small redox protein important in cellular antioxidant defenses, as well as in the regulation of apoptosis. Thioredoxin-2 / TXN2 has an anti-apoptotic function and plays an important role in the regulation of mitochondrial membrane potential. Thioredoxin-2 / TXN2 could be involved in the resistance to anti-tumor agents. It possesses a dithiol-reducing activity. Thioredoxin-2 / TXN2 plays an important role in protecting the mitochondria against oxidative stress and in sensitizing the cells to ROS-induced apoptosis. Mammalian Thioredoxin-2 / TXN2 is a mitochondrial isoform of highly evolutionary conserved thioredoxins. Thioredoxins are small ubiquitous protein-disulfide oxidoreductases implicated in a large variety of biological functions.

Referências
  • Chen Y., et al., 2002, J. Biol. Chem. 277: 33242-8.
  • Smeets A., et al., 2005, Protein Sci. 14: 2610-21.
  • Wen,S. et al., 2009, Am J Med Genet A  149A (2): 155-60.
  • Choudhary C., et al., 2009, Science 325: 834-40.
  • Size / Price
    Catálogo: HG12557-NH
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
    Imagens
        Itens recentemente visualizados
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"