Encomenda rápida

Humano Thioredoxin-2/TXN2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta

    Folha de dadosAnálisesProdutos relacionadosProtocolos
    Humano TXN2 Informações sobre o produto de clone de cDNA
    Gene_bank_ref_id:BC013726
    Tamanho de cDNA:501bp
    Descrição de cDNA:Full length Clone DNA of Homo sapiens thioredoxin 2 with N terminal His tag.
    Sinónimo de gene:MTRX, TRX2, MT-TRX
    Espécie:Human
    Vetor:pCMV3-N-His
    Plasmid:
    Local de restrição:
    Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Descrição da sequência:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with TXN2 qPCR primers for gene expression analysis, HP104573 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    Humano Thioredoxin-2/TXN2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta on other vectors
    Humano Thioredoxin-2/TXN2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG12557-ACG$225
    Humano Thioredoxin-2/TXN2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG12557-ACR$225
    Humano Thioredoxin-2/TXN2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaHG12557-ANG$225
    Humano Thioredoxin-2/TXN2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaHG12557-ANR$225
    Humano Thioredoxin-2/TXN2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG12557-CF$195
    Humano Thioredoxin-2/TXN2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG12557-CH$195
    Humano Thioredoxin-2/TXN2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG12557-CM$195
    Humano Thioredoxin-2/TXN2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG12557-CY$195
    Humano Thioredoxin-2/TXN2 clonagem de ADN ou de clonagem do gene (vector de expressão)HG12557-G$75
    Humano Thioredoxin-2/TXN2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG12557-NF$195
    Humano Thioredoxin-2/TXN2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG12557-NH$195
    Humano Thioredoxin-2/TXN2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG12557-NM$195
    Humano Thioredoxin-2/TXN2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG12557-NY$195
    Humano Thioredoxin-2/TXN2 clonagem de ADN ou de clonagem do gene (vector de clonagem)HG12557-UT$195
     Saiba mais sobre vectores de expressão
    Product nameProduct name
    Fundo

    Thioredoxin-2, also known as TXN2, MTRX and TRX2, is a member of the thioredoxin family. Tryparedoxins (TXN) are thioredoxin-related proteins which, as trypanothione:peroxiredoxin oxidoreductases, constitute the trypanothione-dependent antioxidant defense and may also serve as substrates for ribonucleotide reductase in trypanosomatids. Thioredoxin-2 / TXN2 contains one thioredoxin domain. It is widely expressed in adult (at protein level) and fetal tissues. Human Thioredoxin-2 / TXN2 is a small redox protein important in cellular antioxidant defenses, as well as in the regulation of apoptosis. Thioredoxin-2 / TXN2 has an anti-apoptotic function and plays an important role in the regulation of mitochondrial membrane potential. Thioredoxin-2 / TXN2 could be involved in the resistance to anti-tumor agents. It possesses a dithiol-reducing activity. Thioredoxin-2 / TXN2 plays an important role in protecting the mitochondria against oxidative stress and in sensitizing the cells to ROS-induced apoptosis. Mammalian Thioredoxin-2 / TXN2 is a mitochondrial isoform of highly evolutionary conserved thioredoxins. Thioredoxins are small ubiquitous protein-disulfide oxidoreductases implicated in a large variety of biological functions.

    Referências
  • Chen Y., et al., 2002, J. Biol. Chem. 277: 33242-8.
  • Smeets A., et al., 2005, Protein Sci. 14: 2610-21.
  • Wen,S. et al., 2009, Am J Med Genet A  149A (2): 155-60.
  • Choudhary C., et al., 2009, Science 325: 834-40.
  • Size / Price
    Catálogo: HG12557-NH
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade
    Acrescentar a carrinhoBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
      Itens recentemente visualizados
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"