After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Encomenda rápida

Text Size:AAA

Humano TPSB2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human TPSB2 Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_024164.5
Tamanho de cDNA:828bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens tryptase beta 2 with C terminal HA tag.
Sinónimo de gene:TPS2, TPSB1, tryptaseC
Espécie:Human
Vetor:pCMV3-C-HA
Plasmid:
Local de restrição:
Sequência de etiqueta:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Fundo

Tryptases comprise a family of trypsin-like serine proteases, the peptidase family S1, and fall into two groups, α and β. β-tryptases appear to be the main isoenzymes expressed in mast cells, whereas α-tryptases predominate in basophils. Tryptase is unique in two respects: it is enzymatically active only as a heparin-stabilized tetramer, and it is resistant to all known endogenous proteinase inhibitors because of the unique arrangement of the active sites. Additionally, tryptase family genes have an intron immediately upstream of the initiator codon which separates the transcription initiation site from protein coding sequence, and this feature is characteristic of tryptases. β-tryptases existing in three isoforms (β1,β2,β3) are released in secretory granules, and have been implicated as mediators in the pathogenesis of asthma and other allergic and inflammatory disorders. It has been reported that β-tryptase selectively cleaves ASM-derived eotaxin and RANTES and abrogates their chemotactic activities.

Referências
  • Miller, J.S. et al., 1990, J. Clin. Invest. 86: 864-870.
  • Pereira, P.J. et al., 1998, Nature. 392: 306-311.
  • Pallaoro, M.et al., 1999, J. Biol. Chem. 274: 3355-3362.
  • Pang, L. et al., 2006, J. Immunol. 176: 3788-3795.
  • Size / Price
    Catálogo: HG10505-CY
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
    Imagens
        Itens recentemente visualizados
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"