Encomenda rápida

Humano c-MPL / CD110 / TPOR clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human MPL Informações sobre o produto de clone de cDNA
Tamanho de cDNA:1908bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens myeloproliferative leukemia virus oncogene with C terminal His tag.
Sinónimo de gene:MPLV, TPOR, C-MPL, CD110, MPL
Local de restrição:KpnI (two restriction sites) + XbaI (6kb + 0.99kb + 0.98kb)
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Human MPL Gene Plasmid Map
Human TPO R ORF mammalian expression plasmid, C-His tag
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Humano c-MPL / CD110 / TPOR clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta on other vectors
Humano c-MPL / CD110 / TPOR clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG10443-ACG$245
Humano c-MPL / CD110 / TPOR clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG10443-ACR$245
Humano c-MPL / CD110 / TPOR clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG10443-CF$215
Humano c-MPL / CD110 / TPOR clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG10443-CH$215
Humano c-MPL / CD110 / TPOR clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG10443-CM$215
Humano c-MPL / CD110 / TPOR clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG10443-CY$215
Humano c-MPL / CD110 / TPOR clonagem de ADN ou de clonagem do gene (vector de expressão)HG10443-M$75
Humano c-MPL / CD110 / TPOR clonagem de ADN ou de clonagem do gene (vector de clonagem)HG10443-M-N$215
Humano c-MPL / CD110 / TPOR clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG10443-NF$215
Humano c-MPL / CD110 / TPOR clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG10443-NH$215
Humano c-MPL / CD110 / TPOR clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG10443-NM$215
Humano c-MPL / CD110 / TPOR clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG10443-NY$215
Humano c-MPL / CD110 / TPOR clonagem de ADN ou de clonagem do gene (vector de clonagem)HG10443-UT$215
 Saiba mais sobre vectores de expressão
Product nameProduct name

CD110, also known as c-MPL, is a 635 amino acid transmembrane domain, with two extracellular cytokine receptor domains and two intracellular cytokine receptor box motifs. It is expressed at a low level in a large number of cells of hematopoietic origin. C-MPL is homologous with members of the hematopoietic receptor superfamily. Presence of anti-sense oligodeoxynucleotides of c-mpl inhibited megakaryocyte colony formation. Thrombopoietin is the ligand for c-mpl. It was shown to be the major regulator of megakaryocytopoiesis and platelet formation. Defects in c-MPL are a cause of congenital amegakaryocytic thrombocytopeniawhich is a disease characterized by isolated thrombocytopenia and megakaryocytopenia with no physical anomalies. Defects in c-MPL also cause thrombocythemia type 2 and myelofibrosis with myeloid metaplasia.

Size / Price
Catálogo: HG10443-CH
Preço de catálogo: 
Preço:      (You Save: )
DisponibilidadeIn Stock
Bulk Discount RequiryAcrescentar a carrinho
Contact Us
  • Human TPO R ORF mammalian expression plasmid, C-His tag
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.