Encomenda rápida

Humano TNFSF18 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc Etiqueta

    Folha de dadosAnálisesProdutos relacionadosProtocolos
    Humano TNFSF18 Informações sobre o produto de clone de cDNA
    Tamanho de cDNA:600bp
    Descrição de cDNA:Full length Clone DNA of Homo sapiens tumor necrosis factor (ligand) superfamily, member 18 with N terminal Myc tag.
    Sinónimo de gene:TL6, AITRL, GITRL, hGITRL
    Local de restrição:
    Sequência de etiqueta:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
    Descrição da sequência:
    ( We provide with TNFSF18 qPCR primers for gene expression analysis, HP104622 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
    Myc Tag Info

    A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

    The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

    Product nameProduct name

    The protein encoded by this gene is a cytokine that belongs to the tumor necrosis factor (TNF) ligand family. This cytokine is a ligand for receptor TNFRSF18/AITR/GITR. It has been shown to modulate T lymphocyte survival in peripheral tissues. This cytokine is also found to be expressed in endothelial cells, and is thought to be important for interaction between T lymphocytes and endothelial cells.

    Immune Checkpoint
    Immune Checkpoint Targets   Co-stimulatory Immune Checkpoint Targets

    Immunotherapy   Cancer Immunotherapy   Targeted Therapy

  • Liu Y, Tang X, Tian J, et al. Th17/Treg Cells Imbalance and GITRL Profile in Patients with Hashimoto’s Thyroiditis. Nicot C, ed. International Journal of Molecular Sciences. 2014;15(12):21674-21686.
  • Size / Price
    Catálogo: HG16080-NM
    Preço de catálogo: 
    Preço:      (You Save: )
    Acrescentar a carrinhoBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
      Itens recentemente visualizados
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.