After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Encomenda rápida

Text Size:AAA

Humano TNFSF13 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human TNFSF13 Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_003808.3
Tamanho de cDNA:753bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens tumor necrosis factor (ligand) superfamily, member 13 with C terminal Myc tag.
Sinónimo de gene:APRIL, CD256, TALL2, TRDL-1, ligand, UNQ383/PRO715
Espécie:Human
Vetor:pCMV3-C-Myc
Plasmid:pCMV3-TNFSF13-Myc
Local de restrição:KpnI + XbaI (6kb + 0.8kb)
Sequência de etiqueta:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Descrição da sequência:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Human TNFSF13 Gene Plasmid Map
Human TNFSF13 natural ORF mammalian expression plasmid, C-Myc tag
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Fundo

TNFSF13 is a member of the tumor necrosis factor (TNF) ligand family. It is a ligand for TNFRSF17/BCMA. TNFSF13 is lowly expressed in normal tissues, but is elevated in several types of tumors and transformed cell lines. It is mportant for B cell development. TNFSF13 may also play a role in T-independent type II antigen responses and T cell survival, and induce proliferation/survival of non lymphoid cells. It exists as a functional homotrimer. It can bind to two cell surface receptors, BCMA and TACI, which it shares with BAFF to exert downstream T- and B-cell regulatory effects. TNFSF13 also has been demonstrated to bind to proteoglycans on the cell surface.

Referências
  • Bossen C, et al. (2007) BAFF, APRIL and their receptors: structure, function and signaling. Semin. Immunol. 18(5):263-75.
  • Tangye SG, et al. (2007) BAFF, APRIL and human B cell disorders. Immunol. 18(5): 305-17.
  • Osman W, et al. (2012) Association of common variants in TNFRSF13B, TNFSF13, and ANXA3 with serum levels of non-albumin protein and immunoglobulin isotypes in Japanese. PLoS One. 7(4):e32683.
  • Size / Price
    Catálogo: HG10610-CM
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    DisponibilidadeIn Stock
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
    Imagens
    • Human TNFSF13 natural ORF mammalian expression plasmid, C-Myc tag
      Itens recentemente visualizados
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"