Encomenda rápida

Text Size:AAA

Humano TMEM27 clonagem de ADN ou de clonagem do gene (vector de clonagem)

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human TMEM27 Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:BC014317
Tamanho de cDNA:669bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens transmembrane protein 27.
Sinónimo de gene:NX17, NX-17, TMEM27
Espécie:Human
Vetor:pCMV3-untagged
Plasmid:
Local de restrição:
Sequência de etiqueta:
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Fundo

TMEM27 is a membrane protein. It has been proposed as a beta cell mass biomarker since it is cleaved and shed by pancreatic beta cells. Overexpression of TMEM27 leads to increased thymidine incorporation, whereas silencing of Tmem27 using RNAi results in a reduction of cell replication. Furthermore, transgenic mice with increased expression of Tmem27 in pancreatic beta cells exhibit increased beta cell mass. TMEM27 is also important for trafficking amino acid transporters to the apical brush border of proximal tubules.

Referências
  • Pasquali L, et al. (2009) Collectrin gene screening in Turner syndrome patients with kidney malformation. J Genet. 88(1):105-8.
  • Tosetto E, et al. (2009) Locus heterogeneity of Dent's disease: OCRL1 and TMEM27 genes in patients with no CLCN5 mutations. Pediatr Nephrol. 24(10):1967-73.
  • Singer D, et al. (2011) Collectrin and ACE2 in renal and intestinal amino acid transport. Channels (Austin). 5(5):410-23.
  • Size / Price
    Catálogo: HG13301-UT
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
    Imagens
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"