Encomenda rápida

Humano TMEM25 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human TMEM25 Informações sobre o produto de clone de cDNA
Tamanho de cDNA:969bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens transmembrane protein 25 with N terminal Myc tag.
Sinónimo de gene:UNQ2531/PRO6030, FLJ14399, TMEM25
Local de restrição:
Sequência de etiqueta:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name

TMEM25 is a novel member of the immunoglobulin superfamily. Immunoglobulin superfamily members are implicated in immune responses, growth factor signaling, and cell adhesion. TMEM25 contains 1 Ig-like (immunoglobulin-like) domain and is a target of pharmacogenomics in the field of oncology and regenerative medicine. TMEM25 isoform 1, consisting of exons 1-9, encoded a 366-aa transmembrane protein. TMEM25 isoform 2, consisting of exons 1-4 and 6-9, encoded a 322-aa secreted protein. TMEM25 mRNA was expressed in brain, including cerebellar cortex and hippocampus, as well as in neuroblastoma, brain tumors, and gastric cancer. Human TMEM25 gene was located at the 11q23.3 oncogenomic recombination hotspot around the MLL amplicon and the neuroblastoma deleted region.

  • Grouse LH, et al. (2003) Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. Proc Natl Acad Sci. 99(26):16899-903.
  • Suzuki Y, et al. (1997) Construction and characterization of a full length-enriched and a 5'-end-enriched cDNA library. Gene. 200(1-2):149-56.
  • Sugano S, et al. (1994) Oligo-capping: a simple method to replace the cap structure of eukaryotic mRNAs with oligoribonucleotides. Gene. 138(1-2):171-4.
  • Katoh M, et al. (2004) Identification and characterization of human TMEM25 and mouse Tmem25 genes in silico. Oncol Rep. 12(2):429-33.
  • Size / Price
    Catálogo: HG13750-NM
    Preço de catálogo: 
    Preço:      (You Save: )
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.