Encomenda rápida

Humano TMEM132A clonagem de ADN ou de clonagem do gene (vector de clonagem)

    Folha de dadosAnálisesProdutos relacionadosProtocolos
    Humano TMEM132A Informações sobre o produto de clone de cDNA
    Gene_bank_ref_id:NM_178031.2
    Tamanho de cDNA:3072bp
    Descrição de cDNA:Full length Clone DNA of Homo sapiens transmembrane protein 132A.
    Sinónimo de gene:GBP, FLJ20539, HSPA5BP1, MGC138669, DKFZp547E212, TMEM132A
    Espécie:Human
    Vetor:pCMV3-untagged
    Plasmid:
    Local de restrição:
    Sequência de etiqueta:
    Descrição da sequência:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with TMEM132A qPCR primers for gene expression analysis, HP102120 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
    Product nameProduct name
    Size / Price
    Catálogo: HG13418-UT
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade
    Acrescentar a carrinhoBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"