Encomenda rápida

Text Size:AAA

Humano TMED4 / ERS25 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human TMED4 Informações sobre o produto de clone de cDNA
Tamanho de cDNA:684bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens transmembrane emp24 protein transport domain conta with N terminal Myc tag.
Sinónimo de gene:HNLF, ERS25, TMED4
Local de restrição:
Sequência de etiqueta:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name

TMED4, also known as ERS25, belongs to the EMP24/GP25L family. TMED4 may play a role in the regulation of heat-shock response and apoptosis. It is involved in vesicular protein trafficking, mainly in the early secretory pathway. TMED4 may also play a role in the biosynthesis of secreted cargo including processing. It functions in the regulation of heat-shock response and apoptosis. TMED4 also is involved in endoplasmic reticulum stress response.

  • Hartley JL. et al., 2001, Genome Res. 10 (11): 1788-95.
  • Matoba R. et al., 1994, Gene. 146 (2): 199-207.
  • Matsuda A. et al., 2003, Oncogene. 22 (21): 3307-18.
  • Size / Price
    Catálogo: HG13729-NM
    Preço de catálogo: 
    Preço:      (You Save: )
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
        Itens recentemente visualizados
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.