Encomenda rápida

Text Size:AAA

Humano TLR4 / TLR-4 transcript variant 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human TLR4 Informações sobre o produto de clone de cDNA
Tamanho de cDNA:2520bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens toll-like receptor 4, transcript variant 1 with N terminal Myc tag.
Sinónimo de gene:TOLL, CD284, hToll, ARMD10
Local de restrição:KpnI + NotI (6kb + 2.54kb)
Sequência de etiqueta:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Descrição da sequência:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Human TLR4 Gene Plasmid Map
Human TLR4 transcript variant 1 natural ORF mammalian expression plasmid, N-Myc tag
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Humano TLR4 / TLR-4 transcript variant 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc Etiqueta on other vectors
Humano TLR4 / TLR-4 transcript variant 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG10146-ACG$325
Humano TLR4 / TLR-4 transcript variant 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG10146-ACR$325
Humano TLR4 / TLR-4 transcript variant 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG10146-CF$295
Humano TLR4 / TLR-4 transcript variant 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG10146-CH$295
Humano TLR4 / TLR-4 transcript variant 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG10146-CM$295
Humano TLR4 / TLR-4 transcript variant 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG10146-CY$295
Humano TLR4 / TLR-4 transcript variant 1 clonagem de ADN ou de clonagem do gene (vector de expressão)HG10146-M$75
Humano TLR4 / TLR-4 transcript variant 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG10146-NF$295
Humano TLR4 / TLR-4 transcript variant 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG10146-NH$295
Humano TLR4 / TLR-4 transcript variant 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG10146-NM$295
Humano TLR4 / TLR-4 transcript variant 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG10146-NY$295
Humano TLR4 / TLR-4 transcript variant 1 clonagem de ADN ou de clonagem do gene (vector de clonagem)HG10146-UT$295
 Saiba mais sobre vectores de expressão
Product nameProduct name

TLR4, also known as TLR-4, is a member of the Toll-like receptor (TLR) family, which plays a fundamental role in pathogen recognition and activation of innate immunity. TLRs are highly conserved from Drosophila to humans and share structural and functional similarities. They recognize pathogen-associated molecular patterns (PAMPs) that are expressed on infectious agents, and mediate the production of cytokines necessary for the development of effective immunity. TLR4 is most abundantly expressed in placenta, and in myelomonocytic subpopulation of the leukocytes. TLR 4 has also been designated as CD284 (cluster of differentiation 284). It has been implicated in signal transduction events induced by lipopolysaccharide (LPS) found in most gram-negative bacteria. TLR4 Cooperates with LY96 and CD14 to mediate the innate immune response to bacterial lipopolysaccharide (LPS). It acts via MYD88, TIRAP and TRAF6, leading to NF-kappa-B activation, cytokine secretion and the inflammatory response. It is also involved in LPS-independent inflammatory responses triggered by Ni(2+).

  • Re, Fabio, et al. (2002) Monomeric recombinant MD-2 binds toll-like receptor 4 tightly and confers lipopolysaccharide responsiveness. J Biol Chem. 277(26):23427-32.
  • Shimazu, R, et al. (1999) MD-2, a Molecule that Confers Lipopolysaccharide Responsiveness on Toll-like Receptor 4. J Exp Med. 189(11):1777-82.
  • Blanco, A M, et al. (2005) Involvement of TLR4/type I IL-1 receptor signaling in the induction of inflammatory mediators and cell death induced by ethanol in cultured astrocytes. Journal of immunology. 175(10):6893-9.
  • Size / Price
    Catálogo: HG10146-NM
    Preço de catálogo: 
    Preço:      (You Save: )
    DisponibilidadeIn Stock
    Bulk Discount RequiryAcrescentar a carrinho
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.